United States
Germany
Japan
United Kingdom
China
XAGE1 (XAGE1B) (NM_001097594) Human Untagged Clone
CAT＃: SC316130
XAGE1B (untagged)-Human X antigen family, member 1B (XAGE1B), transcript variant a
CNY 1,800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT12.1; CT12.1A; CT12.1B; CTP9; GAGED2; XAGE-1; XAGE1; XAGE1B |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001097594 edited
GAAGGAGGGCCGAGGAGTGGAGGGGCTCAGGCGAAGCTGGGGTGCTGTTGGGGGTATCCG AGTCCCAGAAGCACCTGGAACCCCGACAGAAGATTCTGGACTCCCCAGACGGGACCAGGA GAGGGACGGCATGAGCGACACACACAAACACAGAACCACACAGCCAGTCCCAGGAGCCCA GTAATGGAGAGCCCCAAAAAGAAGAACCAGCAGCTGAAAGTCGGGATCCTACACCTGGGC AGCAGACAGAAGAAGATCAGGATACAGCTGAGATCCCAGTGCGCGACATGGAAGGTGATC TGCAAGAGCTGCATCAGTCAAACACCGGGGATAAATCTGGATTTGGGTTCCGGCGTCAAG GTGAAGATAATACCTAAAGAGGAACACTGTAAAATGCCAGAAGCAGGTGAAGAGCAACCA CAAGTTTAAATGAAGACAAGCTGAAACAACGCAAGCTGGTTTTATATTAGATATTTGACT TAAACTATCTCAATAAAGTTTTGCAGCTTTCACCAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001097594 |
| Insert Size | 500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001097594.1, NP_001091063.1 |
| RefSeq Size | 614 bp |
| RefSeq ORF | 441 bp |
| Locus ID | 653220 |
| UniProt ID | Q9HD64 |
| Gene Summary | This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (a, also known as XAGE-1a) encodes the longer isoform (a, also known as isoform XAGE-1b). This variant also includes a major downstream transcription start site, which results in the variant referred to as XAGE-1b in the literature. Both XAGE-1a and XAGE-1b encode the same isoform. This RefSeq contains an in-frame start site 65 codons upstream from the currently annotated site but is not being annotated as a start site since it is in a weak Kozak sequence context and experimental evidence indicates that the downstream AUG is used. (PMID: 12479262 and PMID: 17335148). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219300 | XAGE1B (Myc-DDK-tagged)-Human X antigen family, member 1B (XAGE1B), transcript variant a |
CNY 1,800.00 |
|
| RC219300L1 | Lenti-ORF clone of XAGE1B (Myc-DDK-tagged)-Human X antigen family, member 1B (XAGE1B), transcript variant a |
CNY 4,200.00 |
|
| RC219300L2 | Lenti-ORF clone of XAGE1B (mGFP-tagged)-Human X antigen family, member 1B (XAGE1B), transcript variant a |
CNY 6,840.00 |
|
| RC219300L3 | Lenti-ORF clone of XAGE1B (Myc-DDK-tagged)-Human X antigen family, member 1B (XAGE1B), transcript variant a |
CNY 6,840.00 |
|
| RC219300L4 | Lenti-ORF clone of XAGE1B (mGFP-tagged)-Human X antigen family, member 1B (XAGE1B), transcript variant a |
CNY 6,840.00 |
|
| RG219300 | XAGE1B (tGFP-tagged) - Human X antigen family, member 1B (XAGE1B), transcript variant a |
CNY 3,400.00 |
