PRH2 (NM_001110213) Human Untagged Clone
CAT#: SC317036
PRH2 (untagged)-Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Pr; pr1/Pr2; PRP-1/PRP-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317036 representing NM_001110213.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTCTGATTCTGCTGTCAGTGGCCCTGCTGGCCTTCAGCTCAGCTCAGGACTTAGATGAAGATGTC AGCCAAGAAGACGTTCCCTTGGTAATATCAGATGGAGGAGACTCTGAGCAGTTCATAGATGAGGAGCGT CAGGGACCACCTTTGGGAGGACAGCAATCTCAACCCTCTGCTGGTGATGGGAACCAGAATGATGGCCCT CAGCAGGGACCACCCCAACAAGGAGGCCAGCAGCAACAAGGTCCACCACCTCCTCAGGGAAAGCCACAA GGACCACCCCAACAGGGAGGCCATCCCCCTCCTCCTCAAGGAAGGCCACAAGGACCACCCCAACAGGGA GGCCATCCCCGTCCTCCTCGAGGAAGGCCACAAGGACCACCCCAACAGGGAGGCCATCAGCAAGGTCCT CCCCCACCTCCTCCTGGAAAGCCCCAGGGACCACCTCCCCAAGGGGGCCGCCCACAAGGACCTCCACAG GGGCAGTCTCCTCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001110213 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001110213.1 |
RefSeq Size | 3177 bp |
RefSeq ORF | 501 bp |
Locus ID | 5555 |
UniProt ID | P02810 |
Protein Families | Secreted Protein |
MW | 17 kDa |
Gene Summary | This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid and submandibular/sublingual glands. In western population this locus is commonly biallelic and encodes proline-rich protein (PRP) isoforms, PRP-1 and PRP-2. The reference genome encodes the PRP-1 allele. Certain alleles of this gene are associated with susceptibility to dental caries. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, Oct 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225161 | PRH2 (Myc-DDK-tagged)-Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2 |
CNY 1,200.00 |
|
RC225161L3 | Lenti ORF clone of Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225161L4 | Lenti ORF clone of Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225161 | PRH2 (tGFP-tagged) - Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2 |
CNY 4,370.00 |