Tropomyosin 3 (TPM3) (NM_152263) Human Untagged Clone
CAT#: SC319334
TPM3 (untagged)-Human tropomyosin 3 (TPM3), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAPM1; CFTD; HEL-189; HEL-S-82p; hscp30; NEM1; OK/SW-cl.5; TM-5; TM3; TM5; TM30; TM30nm; TPM3nu; TPMsk3; TRK |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_152263 edited
GGTCACTCAGGCAGCAGCCCCTTCTTTCTTGCCCCAGTCTCCAGTTCTCCAGTGTTCACA GGTGAGCCTACCAACAGCCACTGCTCATGATGGAGGCCATCAAGAAAAAGATGCAGATGC TGAAGTTAGACAAGGAGAATGCTCTGGATCGGGCAGAGCAAGCTGAAGCTGAGCAGAAGC AGGCAGAAGAAAGAAGTAAACAGCTGGAGGATGAGCTGGCAGCCATGCAGAAGAAGCTGA AAGGGACAGAGGATGAGCTGGACAAGTATTCTGAAGCTTTGAAGGATGCCCAGGAGAAGC TGGAACTGGCAGAGAAGAAGGCTGCTGATGCTGAGGCTGAGGTGGCCTCCTTGAACCGTA GGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGC AAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTG AAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAG CTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGA TCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCTAAGTGTT CTGAGCTGGAGGAGGAGCTGAAGAATGTCACCAACAACCTCAAGTCTCTTGAGGCTCAGG CGGAGAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATA AACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAA AGACAATTGATGACCTGGAAGATGAGCTCTATGCCCAGAAACTGAAGTACAAGGCCATTA GCGAGGAGCTGGACCACGCCCTCAATGACATGACCTCTATATAATTATCACCGTTTCTGC TCTGTTCTGGATCTGCCCCCTTTACTCCTCGGGGAACCCAAGGCCCCACTCTCGCTCTGG ATTCCATTTGGGTCAGCCTGGCTGGTCCCCAAGGCATTAGGATGGGGGAGCAAAAAGCAA CTTATGTATTTTCTTCCACCCCCACCCCAAATTAAAATGTTAAGCTGCCAAAAAAAAAAA AAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_152263 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152263.2, NP_689476.2 |
RefSeq Size | 7116 bp |
RefSeq ORF | 858 bp |
Locus ID | 7170 |
UniProt ID | P06753 |
Domains | Tropomyosin |
Protein Pathways | Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Pathways in cancer, Thyroid cancer |
Gene Summary | This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (Tpm3.12, also known as variant 1) differs in the 5' and 3' UTRs and contains multiple differences in the coding region, compared to variant Tpm3.1. It represents use of an alternate promoter and initiates translation at an alternate start codon. The encoded isoform (Tpm3.12st, also known as Tm sk alpha-slow, alpha s Tm1, or isoform 1) is longer and has distinct N- and C- termini, compared to isoform Tpm3.1cy. Expression of the encoded isoform is enriched in slow-twitch skeletal muscle. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203276 | TPM3 (Myc-DDK-tagged)-Human tropomyosin 3 (TPM3), transcript variant 1 |
CNY 2,400.00 |
|
RC203276L1 | Lenti ORF clone of Human tropomyosin 3 (TPM3), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC203276L2 | Lenti ORF clone of Human tropomyosin 3 (TPM3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC203276L3 | Lenti ORF clone of Human tropomyosin 3 (TPM3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203276L4 | Lenti ORF clone of Human tropomyosin 3 (TPM3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG203276 | TPM3 (tGFP-tagged) - Human tropomyosin 3 (TPM3), transcript variant 1 |
CNY 4,000.00 |
|
SC317415 | TPM3 (untagged)-Human tropomyosin 3 (TPM3), transcript variant 1 |
CNY 6,270.00 |
其它Tropomyosin 3产品