ICT1 (MRPL58) (NM_001545) Human Untagged Clone
CAT#: SC324666
ICT1 (untagged)-Human immature colon carcinoma transcript 1 (ICT1)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DS-1; DS1; ICT1; MRP-L58 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001545.1
CTGAGCATGGCGGCCACCAGGTGCCTGCGCTGGGGCCTGAGCCGAGCCGGAGTCTGGCTG
CTCCCACCGCCCGCACGGTGCCCACGCCGGGCGCTGCACAAGCAGAAAGACGGCACTGAG TTCAAGAGCATCTACAGCCTGGACAAGCTCTACCCCGAATCTCAGGGCTCGGACACCGCC TGGAGGGTCCCGAATGGTGCAAAGCAAGCCGACAGTGACATCCCTCTAGATCGCTTGACA ATATCTTATTGTCGGAGTAGTGGTCCTGGGGGGCAGAATGTGAACAAAGTGAATTCCAAG GCAGAAGTCAGGTTCCATTTGGCAACTGCCGAGTGGATCGCGGAGCCCGTGCGGCAGAAG ATAGCCATCACGCATAAAAACAAGATCAACAGGTTAGGAGAGTTGATCCTCACCTCTGAG AGCAGCCGCTATCAGTTCCGGAATCTGGCAGATTGCCTGCAGAAAATTCGAGACATGATC ACTGAGGCCAGCCAGACACCGAAGGAGCCAACAAAAGAAGATGTTAAACTTCATAGAATC AGGATAGAAAACATGAATCGGGAAAGGCTGAGACAAAAGAGAATTCATTCTGCTGTAAAG ACAAGCAGGAGGGTCGACATGGACTGAAATCACCCTCTGCAGCTGGGAGGGCTCTTCTGG GCGTCCGGGCAGCTGCAGCTGAGAGGACTTTCACACCATAAGGAGATTTCTGTTTTTCTT TTTGGCTGTTAATGCTTGTCTATAACATTGGAGCCATCACAAGAATGTTCATTTGGAATG AAGGCTGCAGGCACTGGTTGCAGACGTCTTTATAGGCAGTCACCATGTTGTCAAACCTTA ATAATGCACCTCATGTATTAGTCACAATAAAAATCAGAACTCAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001545 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001545.1, NP_001536.1 |
RefSeq Size | 888 bp |
RefSeq ORF | 621 bp |
Locus ID | 3396 |
UniProt ID | Q14197 |
Gene Summary | The protein encoded by this gene is a peptidyl-tRNA hydrolase and a vital component of the large mitochondrial ribosome. The encoded protein serves as a ribosome release factor for this ribosome, which translates mitochondrial genes. This protein may be responsible for degrading prematurely-terminated polypeptides and for reusing stalled ribosomes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the predominant isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204448 | ICT1 (Myc-DDK-tagged)-Human immature colon carcinoma transcript 1 (ICT1) |
CNY 2,400.00 |
|
RC204448L3 | Lenti ORF clone of Human immature colon carcinoma transcript 1 (ICT1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204448L4 | Lenti ORF clone of Human immature colon carcinoma transcript 1 (ICT1), mGFP tagged |
CNY 5,890.00 |
|
RG204448 | ICT1 (tGFP-tagged) - Human immature colon carcinoma transcript 1 (ICT1) |
CNY 4,000.00 |
|
SC119199 | ICT1 (untagged)-Human immature colon carcinoma transcript 1 (ICT1) |
CNY 2,400.00 |