FXYD3 (NM_001136011) Human Untagged Clone
CAT#: SC324702
FXYD3 (untagged)-Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 7
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MAT8; PLML |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324702 representing NM_001136011.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGAAGGTGACCCTGGGCCTGCTTGTGTTCCTGGCAGGCTTTCCTGTCCTGGACGCCAATGACCTA GAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAGGTTGGCGGGCTCATCTGCGCTGGG GTTCTGTGCGCCATGGGCATCATCATCGTCATGAGTGCAAAATGCAAATGCAAGTTTGGCCAGAAGTCC GGTCACCATCCAGGGGAGACTCCACCTCTCATCACCCCAGGCTCAGCCCAAAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136011 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001136011.1 |
RefSeq Size | 1466 bp |
RefSeq ORF | 264 bp |
Locus ID | 5349 |
UniProt ID | Q14802 |
Protein Families | Ion Channels: Other, Transmembrane |
MW | 9.3 kDa |
Gene Summary | This gene belongs to a small family of FXYD-domain containing regulators of Na+/K+ ATPases which share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD, and containing 7 invariant and 6 highly conserved amino acids. This gene encodes a cell membrane protein that may regulate the function of ion-pumps and ion-channels. This gene may also play a role in tumor progression. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2008] Transcript Variant: This variant (7) lacks an exon in the 5' coding region, compared to variant 3. This difference results in translation initiation from a downstream in-frame ATG and an isoform (1) with a shorter N-terminus when compared to isoform 3. Variants 1 and 7 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227235 | FXYD3 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 7 |
CNY 1,200.00 |
|
RC227235L3 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 7, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227235L4 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 7, mGFP tagged |
CNY 5,890.00 |
|
RG227235 | FXYD3 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 7 |
CNY 4,370.00 |