RABL2B (NM_001130922) Human Untagged Clone

CAT#: SC324810

RABL2B (untagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 6



  "NM_001130922" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RABL2B rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130922, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAAGACAAAACCAAACCGAGTGAGTTGGACCAAGGGAAGTATGATGCTGATGAC
AACGTGAAGATCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGAGAGA
TTTCTCATGGATGGCTTTCAGCCACAGCAGCTGTCCACGTACGCCCTGACCCTGTACAAG
CACACAGCCACGGTAGATGGAAGGACCATCCTTGTGGACTTTTGGGACACGGCAGGCCAG
GAGCGGTTCCAGAGCATGCATGCCTCCTACTACCACAAGGCCCACGCCTGCATCATGGTG
TTTGATGTACAGAGGAAAGTCACCTATAGGAACCTGAGCACCTGGTATACAGAGCTTCGG
GAGTTCAGGCCAGAGATCCCATGCATCGTGGTGGCCAATAAAATTGATGACATAAACGTG
ACCCAAAAAAGCTTCAATTTTGCCAAGAAGTTCTCCCTGCCCCTGTATTTCGTCTCGGCT
GCTGATGGTACCAATGTTGTGAAGCTCTTCAATGATGCAATTCGATTAGCTGTGTCTTAC
AAACAGAACTCCCAGGACTTCATGGATGAGATTTTTCAGGAGCTCGAGAACTTCAGCTTG
GAGCAGGAAGAGGAGGACGTGCCAGACCAGGAACAGAGCAGCAGCATCGAGACCCCATCA
GAGGAGGCGGCCTCTCCCCACAGC
Restriction Sites Please inquire     
ACCN NM_001130922
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130922.1, NP_001124394.1
RefSeq Size 2187 bp
RefSeq ORF 687 bp
Locus ID 11158
UniProt ID Q9UNT1
Protein Families Druggable Genome
Gene Summary The RABL2B protein is a member of the RAB gene family which belongs to the RAS GTPase superfamily. RABL2B is located within a subtelomeric region of 22q13.3. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (6) has multiple differences in the 5' UTR and coding sequence compared to variant 7. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 3. Variants 2, 6, 10, 11 and 12 all encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...