Myotilin (MYOT) (NM_001135940) Human Untagged Clone
CAT#: SC324931
MYOT (untagged)-Human myotilin (MYOT), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LGMD1; LGMD1A; MFM3; TTID; TTOD |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001135940, the custom clone sequence may differ by one or more nucleotides
ATGGCTCGCAGATTGCTAGGACCACAGAATGCAGCTGCTGTGTTTCAAGCTCAGGATGAC AGTGGTGCACAAGACTCGCAGCAACACAACTCAGAACATGCGCGACTGCAAGTTCCTACA TCACAAGTAAGAAGTAGATCAACCTCAAGGGGAGATGTGAATGATCAGGATGCAATCCAG GAGAAATTTTACCCACCACGTTTCATTCAAGTGCCAGAGAACATGTCGATTGATGAAGGA AGATTCTGCAGAATGGACTTCAAAGTGAGTGGACTGCCAGCTCCTGATGTGTCATGGTAT CTAAATGGAAGAACAGTTCAATCAGATGATTTGCACAAAATGATAGTGTCTGAGAAGGGT CTTCATTCACTCATCTTTGAAGTAGTCAGAGCTTCAGATGCAGGGGCTTATGCATGTGTT GCCAAGAATAGAGCAGGAGAAGCCACCTTCACTGTGCAGCTGGATGTCCTTGCAAAAGAA CATAAAAGAGCACCAATGTTTATCTACAAACCACAGAGCAAAAAAGTTTTAGAGGGAGAT TCAGTGAAACTAGAATGCCAGATCTCGGCTATACCTCCACCAAAGCTTTTCTGGAAAAGA AATAATGAAATGGTACAATTCAACACTGACCGAATAAGCTTATATCAAGATAACACTGGA AGAGTTACTTTACTGATAAAAGATGTAAACAAGAAAGATGCTGGGTGGTATACTGTGTCA GCAGTTAATGAAGCTGGAGTGACTACATGTAACACAAGATTAGACGTTACGGCACGTCCA AACCAAACTCTTCCAGCTCCTAAGCAGTTACGGGTTCGACCAACATTCAGCAAATATTTA GCACTTAATGGGAAAGGTTTGAATGTAAAACAAGCTTTTAACCCAGAAGGAGAATTTCAG CGTTTGGCAGCTCAATCTGGACTCTATGAAAGTGAAGAACTT |
Restriction Sites | Please inquire |
ACCN | NM_001135940 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135940.1, NP_001129412.1 |
RefSeq Size | 1808 bp |
RefSeq ORF | 945 bp |
Locus ID | 9499 |
UniProt ID | Q9UBF9 |
Gene Summary | This gene encodes a cystoskeletal protein which plays a significant role in the stability of thin filaments during muscle contraction. This protein binds F-actin, crosslinks actin filaments, and prevents latrunculin A-induced filament disassembly. Mutations in this gene have been associated with limb-girdle muscular dystrophy and myofibrillar myopathies. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.[provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) has an alternate splice site in the 5' region, which results in translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (b) has a shorter N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227183 | MYOT (Myc-DDK-tagged)-Human myotilin (MYOT), transcript variant 2 |
CNY 4,940.00 |
|
RC227183L3 | Lenti-ORF clone of MYOT (Myc-DDK-tagged)-Human myotilin (MYOT), transcript variant 2 |
CNY 6,840.00 |
|
RC227183L4 | Lenti-ORF clone of MYOT (mGFP-tagged)-Human myotilin (MYOT), transcript variant 2 |
CNY 6,840.00 |
|
RG227183 | MYOT (tGFP-tagged) - Human myotilin (MYOT), transcript variant 2 |
CNY 5,420.00 |