TRAF4AF1 (KNSTRN) (NM_001142761) Human Untagged Clone

CAT#: SC325712

KNSTRN (untagged)-Human chromosome 15 open reading frame 23 (C15orf23), transcript variant 2



  "NM_001142761" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-KNSTRN Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C15orf23; HSD11; SKAP; TRAF4AF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325712 representing NM_001142761.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCTCCCGAAGCCCCGCCCCTGGACAGAGTTTTCCGTACAACATGGCTGTCTACAGAGTGCGAT
TCCCACCCACTTCCGCCTAGCTACCGGAAGTTTCTATTTGAAACCCAGGCGGCCGACTTAGCCGGTGGC
ACGACAGTTGCTGCAGGGAATCTTTTAAACGAGAGCGAGAAGGACTGCGGGCAGGACCGGCGGGCTCCT
GGGGTTCAGCCGTGCCGCCTCGTTACGATGACCAGTGTGGTTAAGACAGTGTATAGCCTGCAGCCCCCC
TCTGCGCTGAGCGGCGGCCAGCCGGCAGACACACAAACTCGGGCCACTTCTAAGAGTCTCTTACCTGTT
AGGTCCAAAGAAGTCGATGTTTCCAAACAGCTTCATTCAGGAGGTCCAGAGAATGATGTTACAAAAATC
ACCAAACTGAGACGAGAGAATGGGCAAATGAAAGCTACTGACACTGCCACCAGAAGGAATGTCAGAAAA
GGCTACAAACCACTGAGTAAGCAAAAATCAGAGGAAGAGCTCAAGGACAAGAACCAGCTGTTAGAAGCC
GTCAACAAGCAGTTGCACCAGAAGTTGACTGAAACTCAGGGAGAGCTGAAGGACCTGACCCAGAAGGTA
GAGCTGCTGGAGAAGTTTCGGGACAACTGTTTGGCAATTTTGGAGAGCAAGGGCCTTGATCCAGCTTTA
GGCAGTGAGACCCTGGCATCACGACAAGAATCCACTACTGATCACATGGACTCTATGTTGCTGTTAGAA
ACTTTGCAAGAGGAGCTGAAGCTTTTTAACGAAACAGCCAAAAAGCAGATGGAGGAGTTACAGATTGCT
TGGATGAATCATGGGATATTGCACCAAATGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142761
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142761.1
RefSeq Size 2039 bp
RefSeq ORF 861 bp
Locus ID 90417
UniProt ID Q9Y448
MW 31.9 kDa
Gene Summary Essential component of the mitotic spindle required for faithful chromosome segregation and progression into anaphase (PubMed:19667759). Promotes the metaphase-to-anaphase transition and is required for chromosome alignment, normal timing of sister chromatid segregation, and maintenance of spindle pole architecture (PubMed:19667759, PubMed:22110139). The astrin (SPAG5)-kinastrin (SKAP) complex promotes stable microtubule-kinetochore attachments (PubMed:21402792). Required for kinetochore oscillations and dynamics of microtubule plus-ends during live cell mitosis, possibly by forming a link between spindle microtubule plus-ends and mitotic chromosomes to achieve faithful cell division (PubMed:23035123). May be involved in UV-induced apoptosis via its interaction with PRPF19; however, these results need additional evidences (PubMed:24718257).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...