TLL1 (NM_001204760) Human Untagged Clone

CAT#: SC329764

TLL1 (untagged) - Homo sapiens tolloid-like 1 (TLL1), transcript variant 2



  "NM_001204760" in other vectors (2)

CNY 3,710.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TLL1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASD6; TLL
Vector pCMV6-Entry
Sequence Data
>SC329764 representing NM_001204760.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGTTGGGAACGCTTTCCCCGAGGATGCTCGTGTGGCTGGTGGCCTCGGGGATTGTTTTCTACGGG
GAGCTATGGGTCTGCGCTGGCCTCGATTATGATTACACTTTTGATGGGAACGAAGAGGATAAAACAGAG
ACTATAGATTACAAGGACCCGTGTAAAGCCGCTGTATTTTGGGGCGATATTGCCTTAGATGATGAAGAC
TTAAATATCTTTCAAATAGATAGGACAATTGACCTTACGCAGAACCCCTTTGGAAACCTTGGACATACC
ACAGGTGGACTTGGAGACCATGCTATGTCAAAGAAGCGAGGGGCCCTCTACCAACTTATAGACAGGATA
AGAAGAATTGGCTTTGGCTTGGAGCAAAACAACACAGTTAAGGGAAAAGTACCTCTACAATTCTCAGGG
CAAAATGAGAAAAATCGAGTTCCCAGAGCCGCTACATCAAGAACGGAAAGAATATGGCCTGGAGGCGTT
ATTCCTTATGTTATAGGAGGAAACTTCACTGGCAGCCAGAGAGCCATGTTCAAGCAGGCCATGAGGCAC
TGGGAAAAGCACACATGTGTGACTTTCATAGAAAGAAGTGATGAAGAGAGTTACATTGTATTCACCTAT
AGGCCTTGTGGATGCTGCTCCTATGTAGGTCGGCGAGGAAATGGACCTCAGGCAATCTCTATCGGCAAG
AACTGTGATAAATTTGGGATTGTTGTTCATGAATTGGGTCATGTGATAGGCTTTTGGCATGAACACACA
AGACCAGATCGAGATAACCACGTAACTATCATAAGAGAAAACATCCAGCCAGGTCAAGAGTACAATTTT
CTGAAGATGGAGCCTGGAGAAGTAAACTCACTTGGAGAAAGATATGATTTCGACAGTATCATGCACTAT
GCCAGGAACACCTTCTCAAGGGGGATGTTTCTGGATACCATTCTCCCCTCCCGTGATGATAATGGCATA
CGTCCTGCAATTGGTCAGCGAACCCGTCTAAGCAAAGGAGATATCGCACAGGCAAGAAAGCTGTATAGA
TGTCCAGCATGTGGAGAAACTCTACAAGAATCCAATGGCAACCTTTCCTCTCCAGGATTTCCCAATGGC
TACCCTTCTTACACACACTGCATCTGGAGAGTTTCTGTGACCCCAGGGGAGAAGGTTGTATTTTCACTC
TGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204760
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204760.1
RefSeq Size 2332 bp
RefSeq ORF 1179 bp
Locus ID 7092
UniProt ID O43897
Protein Families Druggable Genome, Protease, Secreted Protein
MW 44.2 kDa
Gene Summary This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2) is missing many exons from the 3' end, and contains a novel 3' terminal exon compared to variant 1. This results in a frame-shift, and a much shorter isoform (2) with a distinct C-terminus compared to isoform 1. This isoform lacks experimental support.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...