NUDT2 (NM_001244390) Human Untagged Clone

CAT#: SC330210

NUDT2 (untagged) - Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 4



  "NM_001244390" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NUDT2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APAH1
Vector pCMV6-Entry
Sequence Data
>SC330210 representing NM_001244390.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTTGAGAGCATGTGGCTTGATCATCTTCCGAAGATGCCTCATTCCCAAAGTGGACAACAATGCA
ATTGAGTTTTTACTGCTGCAGGCATCAGATGGCATTCATCACTGGACTCCTCCCAAAGGCCATGTGGAA
CCAGGAGAGGATGACTTGGAAACAGCCCTGAGGGAGACCCAAGAGGAAGCAGGCATAGAAGCAGGCCAG
CTGACCATTATTGAGGGGTTCAAAAGGGAACTCAATTATGTGGCCAGGAACAAGCCTAAAACAGTCATT
TACTGGCTGGCGGAGGTGAAGGACTATGACGTGGAGATCCGCCTCTCCCATGAGCACCAAGCCTACCGC
TGGCTGGGGCTGGAGGAGGCCTGCCAGTTGGCTCAGTTCAAGGAGATGAAGGCAGCGCTCCAAGAAGGA
CACCAGTTTCTTTGCTCCATAGAGGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244390
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244390.1
RefSeq Size 843 bp
RefSeq ORF 444 bp
Locus ID 318
UniProt ID P50583
Protein Pathways Purine metabolism, Pyrimidine metabolism
MW 16.8 kDa
Gene Summary This gene encodes a member of the MutT family of nucleotide pyrophosphatases, a subset of the larger NUDIX hydrolase family. The gene product possesses a modification of the MutT sequence motif found in certain nucleotide pyrophosphatases. The enzyme asymmetrically hydrolyzes Ap4A to yield AMP and ATP and is responsible for maintaining the intracellular level of the dinucleotide Ap4A, the function of which has yet to be established. This gene may be a candidate tumor suppressor gene. Alternative splicing has been observed at this locus and four transcript variants, all encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (4) lacks two alternate 5' UTR exons compared to variant 1. All four variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...