FRMD3 (NM_001244961) Human Untagged Clone

CAT#: SC330235

FRMD3 (untagged) - Homo sapiens FERM domain containing 3 (FRMD3), transcript variant 4



  "NM_001244961" in other vectors (2)

CNY 3,520.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal FRMD3 Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 4.1O; EPB41L4O; EPB41LO; P410
Vector pCMV6-Entry
Sequence Data
>SC330235 representing NM_001244961.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGTTCAGAAGGGGGCAGAGCCCACCAGTTGCTGAATTTAACTTGCTCCTGAAAGCTCACACTTTG
GAAACCTACGGGGTGGATCCTCACCCATGCAAGGATTCAACAGGCACAACAACATTTTTAGGATTCACA
GCTGCAGGCTTTGTGGTCTTTCAGGGAAATAAGAGAATCCATTTGATAAAATGGCCAGATGTCTGCAAA
TTGAAGTTTGAAGGGAAGACATTTTATGTGATTGGCACCCAGAAGGAGAAAAAAGCCATGTTGGCATTC
CATACTTCAACACCAGCTGCCTGCAAACATCTTTGGAAGTGTGGAGTGGAAAACCAGGCCTTTTATAAG
TATGCAAAATCCAGTCAGATCAAGACTGTATCAAGCAGCAAGATATTTTTTAAAGGAAGTAGATTTCGA
TATAGTGGGAAAGTTGCCAAAGAGGTGGTGGAGGCCAGTTCCAAGATCCAGAGGGAGCCTCCTGAGGTG
CACAGAGCCAACATTACTCAGAGCCGCAGTTCCCACTCCTTGAACAAACAGCTCATCATTAACATGGAA
CCCCTGCAGCCCCTGCTTCCTTCCCCCAGCGAGCAAGAAGAAGAACTTCCTCTGGGTGAGGGTGTTCCA
TTGCCTAAAGAGGAGAACATTTCTGCTCCCTTGATCTCCAGCTCCCCAGTGAAGGCAGCCCGGGAGTAT
GAAGATCCCCCTAGTGAAGAGGAAGATAAAATAAAAGAAGAACCTTTAACCATCTCTGAACTAGTGTAC
AACCCAAGTGCCAGCCTGCTCCCCACCCCTGTGGATGACGATGAGATTGACATGCTCTTTGACTGTCCT
TCTAGGCTTGAGTTGGAAAGAGAAGACACAGATTCATTTGAGGATCTGGAAGCAGATGAAAACGCCTTT
TTGATTGCTGAAGAAGAGGAGCTGAAGGAGGCTCGCCGTGCTTTGTCGTGGAGCTATGACATTCTGACT
GGCCATATTCGGGTGAACCCACTGGTCAAGAGTTTTTCCAGGCTCCTTGTGGTGGGCCTGGGACTGCTG
CTCTTTGTATTTCCCCTGCTCCTCCTCCTTTTGGAGTCAGTCTCCATGCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001244961
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244961.1
RefSeq Size 1415 bp
RefSeq ORF 1089 bp
Locus ID 257019
UniProt ID A2A2Y4
Protein Families Transmembrane
MW 40.7 kDa
Gene Summary The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) lacks the first exon compared to variant 1 and has an alternate, downstream first exon instead. It also uses an alternate splice junction at the 3' end of an exon and has an alternate 3' terminal exon compared to variant 1. The resulting isoform (4) has shorter and distinct N and C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...