FBXO7 (NM_001257990) Human Untagged Clone

CAT#: SC330625

FBXO7 (untagged) - Homo sapiens F-box protein 7 (FBXO7), transcript variant 3



  "NM_001257990" in other vectors (2)

CNY 3,900.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-FBXO7 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBX; FBX07; FBX7; PARK15; PKPS
Vector pCMV6-Entry
Sequence Data
>SC330625 representing NM_001257990.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGGATGAACAACCAAGTGATTCATTCCAAGGACAGGCAGCCCAGTCTGGTGTTTGGAATGACGAC
AGTATGTTAGGGCCTAGTCAAAATTTTGAAGCTGAGTCAATTCAAGATAATGCGCATATGGCAGAGGGC
ACAGGTTTCTATCCCTCAGAACCCATGCTCTGTAGTGAATCGGTGGAAGGGCAAGTGCCACATTCATTA
GAGACCTTGTATCAATCAGCTGACTGTTCTGATGCCAATGATGCCTTGATAGTGTTGATACATCTTCTC
ATGTTGGAGTCAGGTTACATACCTCAGGGCACCGAAGCCAAAGCACTGTCCATGCCGGAGAAGTGGAAG
TTGAGCGGGGTGTATAAGCTGCAGTACATGCATCCTCTCTGCGAGGGCAGCTCCGCTACTCTCACCTGT
GTGCCTTTGGGAAACCTGATTGTTGTAAATGCTACACTAAAAATCAACAATGAGATTAGAAGTGTGAAA
AGATTGCAGCTGCTACCAGAATCTTTTATTTGCAAAGAGAAACTAGGGGAAAATGTAGCCAACATATAC
AAAGATCTTCAGAAACTCTCTCGCCTCTTTAAAGACCAGCTGGTGTATCCTCTTCTGGCTTTTACCCGA
CAAGCACTGAACCTACCAGATGTATTTGGGTTGGTCGTCCTCCCATTGGAACTGAAACTACGGATCTTC
CGACTTCTGGATGTTCGTTCCGTCTTGTCTTTGTCTGCGGTTTGTCGTGACCTCTTTACTGCTTCAAAT
GACCCACTCCTGTGGAGGTTTTTATATCTGCGTGATTTTCGAGACAATACTGTCAGAGTTCAAGACACA
GATTGGAAAGAACTGTACAGGAAGAGGCACATACAAAGAAAAGAATCCCCGAAAGGGCGGTTTGTGATG
CTCCTGCCATCGTCAACTCACACCATTCCATTCTATCCCAACCCCTTGCACCCTAGGCCATTTCCTAGC
TCCCGCCTTCCTCCAGGAATTATCGGGGGTGAATATGACCAAAGACCAACACTTCCCTATGTTGGAGAC
CCAATCAGTTCACTCATTCCTGGTCCTGGGGAGACGCCCAGCCAGTTTCCTCCACTGAGACCACGCTTT
GATCCAGTTGGCCCACTTCCAGGACCTAACCCCATCTTGCCAGGGCGAGGCGGCCCCAATGACAGATTT
CCCTTTAGACCCAGCAGGGGTCGGCCAACTGATGGCCGGCTGTCATTCATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257990
Insert Size 1227 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257990.1
RefSeq Size 1910 bp
RefSeq ORF 1227 bp
Locus ID 25793
UniProt ID Q9Y3I1
Protein Families Druggable Genome
MW 45.8 kDa
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) has an alternate exon in place of the first exon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...