Granzyme H (GZMH) (NM_001270781) Human Untagged Clone
CAT#: SC330878
GZMH (untagged) - Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) (GZMH), transcript variant 3
CNY 2,950.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330878 representing NM_001270781.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGCCATTCCTCCTCCTGTTGGCCTTTCTTCTGACCCCTGGGGCTGGGACAGAGGAGATCATCGGG GGCCATGAGGCCAAGCCCCACTCCCGCCCCTACATGGCCTTTGTTCAGTTTCTGCAAGAGAAGAGTCGG AAGAGGTGTGGCGGCATCCTAGTGAGAAAGGACTTTGTGCTGACAGCTGCTCACTGCCAGGGAAGCTCC ATAAATGTCACCTTGGGGGCCCACAATATCAAGGAACAGGAGCGGACCCAGCAGTTTATCCCTGTGAAA AGACCCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCAGGGGGAC TCCGGGGGGCCCCTCGTGTGTAAGGACGTAGCCCAAGGTATTCTCTCCTATGGAAACAAAAAAGGGACA CCTCCAGGAGTCTACATCAAGGTCTCACACTTCCTGCCCTGGATAAAGAGAACAATGAAGCGCCTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270781 |
Insert Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270781.1 |
RefSeq Size | 729 bp |
RefSeq ORF | 483 bp |
Locus ID | 2999 |
UniProt ID | P20718 |
Protein Families | Druggable Genome, Protease |
MW | 17.8 kDa |
Gene Summary | This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 3 which is shorter than isoform 1. This isoform (3) may undergo proteolytic processing similar to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
其它Granzyme H产品
Customer
Reviews
Loading...