UCHL3 (NM_001270952) Human Untagged Clone
CAT#: SC330899
UCHL3 (untagged) - Homo sapiens ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) (UCHL3), transcript variant 1
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UCH-L3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330899 representing NM_001270952.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATCCTGAACTCCTTAGCATGGTACCAAGACCAGTCTGTGCAGTCTTACTTCTCTTTCCTATTACA GAAAAGTATGAAGTATTCAGAACAGAAGAGGAAGAAAAAATAAAATCTCAGGGACAAGATGTTACATCA TCAGTATATTTCATGAAGCAAACAATCAGCAATGCCTGTGGAACAATTGGACTGATTCATGCTATTGCA AACAATAAAGACAAGATGCACTTTGAATCTGGATCAACCTTGAAAAAATTCCTGGAGGAATCTGTGTCA ATGAGCCCTGAAGAACGAGCCAGATACCTGGAGAACTATGATGCCATCCGAGTTACTCATGAGACCAGT GCCCATGAAGGTCAGACTGAGGCACCAAGTATAGATGAGAAAGTAGATCTTCATTTTATTGCATTAGTT CATGTAGATGGGCATCTCTATGAATTAGATGGGCGGAAGCCATTTCCAATTAACCATGGTGAAACTAGT GATGAAACTTTATTAGAGGATGCCATAGAAGTTTGCAAGAAGTTTATGGAGCGCGACCCTGATGAACTA AGATTTAATGCGATTGCTCTTTCTGCAGCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270952 |
Insert Size | 585 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270952.1 |
RefSeq Size | 1050 bp |
RefSeq ORF | 585 bp |
Locus ID | 7347 |
UniProt ID | P15374 |
Protein Families | Druggable Genome, Protease |
MW | 21.9 kDa |
Gene Summary | The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232073 | UCHL3 (Myc-DDK tagged) - Homo sapiens ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) (UCHL3), transcript variant 1 |
CNY 2,640.00 |
|
RG232073 | UCHL3 (tGFP-tagged) - Homo sapiens ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) (UCHL3), transcript variant 1 |
CNY 4,370.00 |