BCL2L2 (NM_001199839) Human Untagged Clone

CAT#: SC331379

BCL2L2 (untagged) - Homo sapiens BCL2-like 2 (BCL2L2), transcript variant 2



  "NM_001199839" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Antibody against BCL2L2
    • 400 ul

CNY 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCL-W; BCL2-L-2; BCLW; PPP1R51
Vector pCMV6-Entry
Sequence Data
>SC331379 representing NM_001199839.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGACCCCAGCCTCGGCCCCAGACACACGGGCTCTGGTGGCAGACTTTGTAGGTTATAAGCTGAGG
CAGAAGGGTTATGTCTGTGGAGCTGGCCCCGGGGAGGGCCCAGCAGCTGACCCGCTGCACCAAGCCATG
CGGGCAGCTGGAGATGAGTTCGAGACCCGCTTCCGGCGCACCTTCTCTGATCTGGCGGCTCAGCTGCAT
GTGACCCCAGGCTCAGCCCAACAACGCTTCACCCAGGTCTCCGATGAACTTTTTCAAGGGGGCCCCAAC
TGGGGCCGCCTTGTAGCCTTCTTTGTCTTTGGGGCTGCACTGTGTGCTGAGAGTGTCAACAAGGAGATG
GAACCACTGGTGGGACAAGTGCAGGAGTGGATGGTGGCCTACCTGGAGACGCGGCTGGCTGACTGGATC
CACAGCAGTGGGGGCTGGGCGGAGTTCACAGCTCTATACGGGGACGGGGCCCTGGAGGAGGCGCGGCGT
CTGCGGGAGGGGAACTGGGCATCAGTGAGGACAGTGCTGACGGGGGCCGTGGCACTGGGGGCCCTGGTA
ACTGTAGGGGCCTTTTTTGCTAGCAAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199839
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199839.1
RefSeq Size 3576 bp
RefSeq ORF 582 bp
Locus ID 599
UniProt ID Q92843
Protein Families Druggable Genome, Transmembrane
MW 20.8 kDa
Gene Summary This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...