Silencer of Death Domain (BAG4) (NM_001204878) Human Untagged Clone

CAT#: SC331624

BAG4 (untagged) - Homo sapiens BCL2-associated athanogene 4 (BAG4), transcript variant 2



  "NM_001204878" in other vectors (2)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal SODD Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAG-4; SODD
Vector pCMV6-Entry
Sequence Data
>SC331624 representing NM_001204878.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGGCCCTGAGGCGCTCGGGCTACGGCCCCAGTGACGGTCCGTCCTACGGCCGCTACTACGGGCCT
GGGGGTGGAGATGTGCCGGTACACCCACCTCCACCCTTATATCCTCTTCGCCCTGAACCTCCCCAGCCT
CCCATTTCCTGGCGGGTGCGCGGGGGCGGCCCGGCGGAGACCACCTGGCTGGGAGAAGGCGGAGGAGGC
GATGGCTACTATCCCTCGGGAGGCGCCTGGCCAGAGCCTGGTCGAGCCGGAGGAAGCCACCAGAGTTTG
AATTCTTATACAAATGGAGCGTATGGTCCAACATACCCCCCAGGCCCTGGGGCAAATACTGCCTCATAC
TCAGGGGCTTATTATGCACCTGGTTATACTCAGACCAGTTACTCCACAGAAGTTCCAAGTACTTACCGT
TCATCTGGCAACAGCCCAACTCCAGTCTCTCGTTGGATCTATCCCCAGCAGGACTGTCAGACTGAAGCA
CCCCCTCTTAGGGGGCAGGTTCCAGGATATCCGCCTTCACAGAACCCTGGAATGACCCTGCCCCATTAT
CCTTATGGAGATGGTAATCGTAGTGTTCCACAATCAGGACCGACTGTACGACCACAAGAAGATGCGTGG
GCTTCTCCTGGTGCTTATGGAATGGGTGGCCGTTATCCCTGGCCTTCATCAGCGCCCTCAGCACCACCC
GGCAATCTCTACATGACTGAAAGTACTTCACCATGGCCTAGCAGTGGCTCTCCCCAGTCACCCCCTTCA
CCCCCAGTCCAGCAGCCCAAGGATTCTTCATACCCCTATAGCCAATCAGATCAAAGCATGAACCGGCAC
AACTTTCCTTGCAGTGTCCATCAGTACGAATCCTCGGGGACAGTGAACAATGATGATTCAGATCTTTTG
GATTCCCAAGTCCAGTATAGTGCTGAGCCTCAGCTGTATGGTAATGCCACCAGTGACCATCCCAACAAT
CAAGATCAAAGTAGCAGTCTTCCTGAAGAATGTGTACCTTCAGATGAAAGTACTCCTCCGAGTATTAAA
AAAATCATACATGTGCTGGAGAAGGTCCAGTATCTTGAACAAGAAGTAGAAGAATTTGTAGGAAAAAAG
ACAGACAAAGCATACTGGCTTCTGGAAGAAATGCTAACCAAGGAACTTTTGGAACTGGATTCAGTTGAA
ACTGGGGGCCAGGACTCTGTACGGCAGGCCAGAAAAGAGGCTGTTTGTAAGATTCAGGCCATACTGGAA
AAATTAGAAAAAAAAGGATTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001204878
Insert Size 1266 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204878.1
RefSeq Size 4370 bp
RefSeq ORF 1266 bp
Locus ID 9530
UniProt ID O95429
Protein Families Druggable Genome
MW 45.4 kDa
Gene Summary The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2) lacks an in-frame coding exon, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...