PBX1 (NM_001204963) Human Untagged Clone

CAT#: SC331633

PBX1 (untagged) - Homo sapiens pre-B-cell leukemia homeobox 1 (PBX1), transcript variant 3



  "NM_001204963" in other vectors (2)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
PBX1 mouse monoclonal antibody, clone OTI1C11 (formerly 1C11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAKUHED
Vector pCMV6-Entry
Sequence Data
>SC331633 representing NM_001204963.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACGAGCAGCCCAGGCTGATGCATTCCCATGCTGGGGTCGGGATGGCCGGACACCCCGGCCTGTCC
CAGCACTTGCAGGATGGGGCCGGAGGGACCGAGGGGGAGGGCGGGAGGAAGCAGGACATTGGAGACATT
TTACAGCAAATTATGACCATCACAGACCAGAGTTTGGATGAGGCGCAGGCCAGAAAACATGCTTTAAAC
TGCCACAGAATGAAGCCTGCCTTGTTTAATGTGTTGTGTGAAATCAAAGAAAAAACAGTTTTGAGTATC
CGAGGAGCCCAGGAGGAGGAACCCACAGACCCCCAGCTGATGCGGCTGGACAACATGCTGTTAGCGGAA
GGCGTGGCGGGGCCTGAGAAGGGCGGAGGGTCGGCGGCAGCGGCGGCAGCGGCGGCGGCTTCTGGAGGG
GCAGGTTCAGACAACTCAGTGGAGCATTCAGATTACAGAGCCAAACTCTCACAGATCAGACAAATCTAC
CATACGGAGCTGGAGAAATACGAGCAGGCCTGCAACGAGTTCACCACCCACGTGATGAATCTCCTGCGA
GAGCAAAGCCGGACCAGGCCCATCTCCCCAAAGGAGATTGAGCGGATGGTCAGCATCATCCACCGCAAG
TTCAGCTCCATCCAGATGCAGCTCAAGCAGAGCACGTGCGAGGCGGTGATGATCCTGCGTTCCCGATTT
CTGGATGCGCGGCGGAAGAGACGGAATTTCAACAAGCAAGCGACAGAAATCCTGAATGAATATTTCTAT
TCCCATCTCAGCAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGTGGCATCACA
GTCTCCCAGGTATCAAACTGGTTTGGAAATAAGCGAATCCGGTACAAGAAGAACATAGGTAAATTTCAA
GAGGAAGCCAATATTTATGCTGCCAAAACAGCTGTCACTGCTACCAATGTGTCAGCCCATGGAAGCCAA
GCTAACTCGCCCTCAACTCCCAACTCGGCTGGTTCTTCCAGTTCTTTTAACATGTCAAACTCTGGAGAT
TTGTTCATGAGCGTGCAGTCACTCAATGGGGATTCTTACCAAGGGGCCCAGGTTGGAGCCAACGTGCAA
TCACAGGTGGATACCCTTCGCCATGTTATCAGCCAGACAGGAGGATACAGTGATGGACTCGCAGCCAGT
CAGATGTACAGTCCGCAGGGCATCAGTCACCTCCCCCGGCACCCCCGGCAAGCCCACTATCACTTCCGA
CTTCCAACGTGGCATCCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204963
Insert Size 1263 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204963.1
RefSeq Size 4162 bp
RefSeq ORF 1263 bp
Locus ID 5087
UniProt ID P40424
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
MW 46.3 kDa
Gene Summary This gene encodes a nuclear protein that belongs to the PBX homeobox family of transcriptional factors. Studies in mice suggest that this gene may be involved in the regulation of osteogenesis and required for skeletal patterning and programming. A chromosomal translocation, t(1;19) involving this gene and TCF3/E2A gene, is associated with pre-B-cell acute lymphoblastic leukemia. The resulting fusion protein, in which the DNA binding domain of E2A is replaced by the DNA binding domain of this protein, transforms cells by constitutively activating transcription of genes regulated by the PBX protein family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2017]
Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (3) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...