PSMC3IP (NM_001256014) Human Untagged Clone

CAT#: SC332280

PSMC3IP (untagged) - Homo sapiens PSMC3 interacting protein (PSMC3IP), transcript variant 3



  "NM_001256014" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PSMC3IP Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GT198; HOP2; HUMGT198A; ODG3; TBPIP
Vector pCMV6-Entry
Sequence Data
>SC332280 representing NM_001256014.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACGGCAAGCAGAAGATCTATTTTGCGGATCAGGACCAGTTTGACATGGTGAGTGATGCTGACCTT
CAAGTCCTAGATGGCAAAATCGTGGCCCTCACTGCTAAGGTGCAGAGCTTGCAGCAGAGCTGCCGCTAC
ATGGAGGCTGAGCTCAAGGAATTATCTAGTGCCCTGACCACACCAGAGATGCAGAAAGAAATCCAGGAG
TTAAAGAAGGAATGCGCTGGCTACAGAGAGAGATTGAAGAACATTAAAGCAGCTACCAATCATGTGACT
CCAGAAGAGAAAGAGCAGGTGTACAGAGAGAGGCAGAAGTACTGTAAGGAGTGGAGGAAGAGGAAGAGG
ATGGCTACAGAGCTGTCTGATGCAATACTTGAAGGATACCCCAAGAGCAAGAAGCAGTTCTTTGAGGAA
GTTGGGATAGAGACGGATGAAGATTACAACGTCACACTCCCAGACCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256014
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256014.1
RefSeq Size 1452 bp
RefSeq ORF 465 bp
Locus ID 29893
UniProt ID Q9P2W1
Protein Families Druggable Genome
MW 18 kDa
Gene Summary This gene encodes a protein that functions in meiotic recombination. It is a subunit of the PSMC3IP/MND1 complex, which interacts with PSMC3/TBP1 to stimulate DMC1- and RAD51-mediated strand exchange during meiosis. The protein encoded by this gene can also co-activate ligand-driven transcription mediated by estrogen, androgen, glucocorticoid, progesterone, and thyroid nuclear receptors. Mutations in this gene cause XX female gonadal dysgenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3, also known as GT198a) differs in the 5' UTR and uses an in-frame downstream start codon, compared to variant 2. The encoded isoform (3) is shorter at the N-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...