CFC1 (NM_001270420) Human Untagged Clone

CAT#: SC332927

CFC1 (untagged) - Homo sapiens cripto, FRL-1, cryptic family 1 (CFC1), transcript variant 2



  "NM_001270420" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CFC1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFC1B; CRYPTIC; DTGA2; HTX2
Vector pCMV6-Entry
Sequence Data
>SC332927 representing NM_001270420.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCTGGAGGCACCATGTCAGGCTTCTGTTTACGGTCAGTTTGGCATTACAGATCATCAATTTGGGA
AACAGCTATCAAAGAGAGAAACATAACGGCGGTAGAGAGGAAGTCACCAAGGTTGCCACTCAGAAGCAC
CGACAGTCACCGCTCAACTGGACCTCCAGTCATTTCGGAGAGGTGACTGGGAGCGCCGAGGGCTGGGGG
CCGGAGGAGCCGCTCCCCTACTCCCGGGCTTTCGGAGAGGTGAATGCGGCGCCCTGGAGCACGGAGCCT
GGACCCTCCGCGCCTGCCACCTCTGCAGGTGCATCTTCGGGGCCCTGCACTGCCTCCCCCTCCAGACGC
CTGACCGCTGTGACCCGAAAGACTTCCTGGCCTCCCACGCTCACGGGCCGAGCGCCGGGGGCGCGCCCA
GCCTGCTACTCTTGCTGCCCTGCGCACTCCTGCACCGCCTCCTGCGCCCGGATGCGCCCGCGCACCCTC
GGTCCCTGGTCCCTTCCGTCCTCCAGCGGGAGCGGCGCCCCTGCGGAAGGCCGGGACTTGGGCATCGCC
TTTAATTTTCTATGTTGTAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001270420
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270420.1
RefSeq Size 1562 bp
RefSeq ORF 576 bp
Locus ID 55997
UniProt ID P0CG37
MW 20.3 kDa
Gene Summary This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...