IQSEC2 (NM_001243197) Human Untagged Clone

CAT#: SC333358

IQSEC2 (untagged) - Human IQ motif and Sec7 domain 2 (IQSEC2), transcript variant 3



  "NM_001243197" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-IQSEC2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRAG1; IQ-ArfGEF; MRX1; MRX18; MRX78
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333358 representing NM_001243197.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCCCCCGGGAGGAGCAGCAGGTCCACAGCGTCTCATACTCTACACCAGTATTGCTGTCCTACT
CAGGTCCTTGACTCCATGAAGCTTACCCCCTCAGGCAGGCTGGCAGAGAGCAGGGAAGAGGAGGAGGAG
GAGGAGACTGAGGAAGAGGAAGAGGAAGACGCTCACCAGTTCTGCTGTCCGGCCTCCGAGTGCAGTAGT
CCCTCCTCTCGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001243197
Insert Size 222 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243197.1
RefSeq Size 971 bp
RefSeq ORF 222 bp
Locus ID 23096
UniProt ID Q5JU85
Protein Pathways Endocytosis
MW 8.2 kDa
Gene Summary This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked cognitive disability. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) shares no exons with variant 1, and differs in the 3' UTR and coding region compared to variant 2. The encoded isoform (3) is significantly shorter and has a distinct C-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...