OPALIN (NM_001284324) Human Untagged Clone
CAT#: SC333791
OPALIN (untagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 8
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HTMP10; TMEM10; TMP10 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333791 representing NM_001284324.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGGATGACGTCCTCTCCTGTCACAGGTGGGAAAGAAACGGACTGTGGGCCCTCTCTTGGATTAGCG GCGGGCATACCATTGCTGGTGGCCACAGCCCTGCTGGTGGCTTTACTATTTACTTTGATTCACCGAAGA AGAAGCAGCATTGAGGCCATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCC AAGATATCTGAGAATCCTAGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCAC ATATATGTGAAGACTGTAGCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATG GAAAGAAGGAGGGGATTGTGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284324 |
Insert Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001284324.1 |
RefSeq Size | 3345 bp |
RefSeq ORF | 396 bp |
Locus ID | 93377 |
UniProt ID | Q96PE5 |
Protein Families | Transmembrane |
MW | 14.7 kDa |
Gene Summary | Central nervous system-specific myelin protein that increase myelin genes expression during oligodendrocyte differentiation. Promotes oligodendrocyte terminal differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) contains two alternate exons and uses an alternate start codon compared to variant 1. It encodes isoform c which is shorter and has a distinct N-terminus compared to isoform a. Variants 3, 6, 7 and 8 encode the same isoform (c). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235897 | OPALIN (myc-DDK-tagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 8 |
CNY 3,990.00 |
|
RG235897 | OPALIN (tGFP-tagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 8 |
CNY 4,370.00 |