TMIGD3 (NM_001302680) Human Untagged Clone

CAT#: SC334199

TMIGD3 (untagged) - Human transmembrane and immunoglobulin domain containing 3 (TMIGD3), transcript variant 4



  "NM_001302680" in other vectors (2)

CNY 2,640.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ADORA3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AD026
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302680, the custom clone sequence may differ by one or more nucleotides


ATGGAAGGGTCTCCAGCAGGACCCATTGAGCAGAAGGAGGCCAGGTGGGAAAGCTCCTGGGAAGAGCAGC
CAGACTGGACACTGGGCTGCTTGAGTCCTGAGTCACACACCAATCATGTGGCCCTGAGGGACACAGGGAA
CCAGCTCATTGTCACTATGTCCTGCCTGACCAAAGAGGACACGGGCTGGTACTGGTGTGGCATCCAGCGG
GACTTTGCCAGGGATGACATGGATTTTACAGAGCTGATTGTAACTGACGACAAAGGAACCCTGGCCAATG
ACTTTTGGTCTGGGAAAGACCTATCAGGCAACAAAACCAGAAGCTGCAAGGCTCCCAAAGTTGTCCGCAA
GGCTGACCGCTCCAGGACGTCCATTCTCATCATTTGCATACTGATCACGGGTTTGGGAATCATCTCTGTA
ATCAGTCATTTGACCAAAAGGAGGAGAAGTCAAAGGAATAGAAGGGTAGGCAACACTTTGAAGCCCTTCT
CGCGTGTCCTGACTCCAAAGGAAATGGCTCCTACTGAACAGATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001302680
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302680.1, NP_001289609.1
RefSeq Size 949 bp
RefSeq ORF 537 bp
Locus ID 57413
UniProt ID P33765
Gene Summary This gene encodes a transmembrane and immunoglobulin domain-containing protein. Alternative splicing results in multiple transcript variants, one of which shares its 5' terminal exon with that of the overlapping adenosine A3 receptor gene (GeneID:140), thus resulting in a fusion product. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (4) contains an alternate 5' terminal exon, lacks an internal exon and uses an alternate splice site in another exon, thus resulting in an alternate 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1, and it does not share any similarity with the adenosine A3 receptor.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...