GRAP2 (NM_001291828) Human Untagged Clone
CAT#: SC334543
GRAP2 (untagged) - Human GRB2-related adaptor protein 2 (GRAP2), transcript variant 5
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
GRAP2 mouse monoclonal antibody, clone OTI1G2 (formerly 1G2)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GADS; GRAP-2; GRB2L; GRBLG; GrbX; Grf40; GRID; GRPL; Mona; P38 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291828, the custom clone sequence may differ by one or more nucleotides
ATGGTTTCACGAAGGCCTCTCTCGACACCAGGCAGAGAACTTACTCATGGGCAAGGAGGTTGGCTTCTTC ATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCATCTCTGTCAGGGTCACCGGGGCAACAGCCT GGACCGGAGGTCCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCTTCGATGAAC CGGAAGCTGTCGGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCACCAGCCACAGCCTCCGCAAT ATGCCCCAGCGCCCCAGCAGCTGCAGCAGCCCCCACAGCAGCGATATCTGCAGCACCACCATTTCCACCA GGAACGCCGAGGAGGCAGCCTTGACATAAATGATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAAT GCGGCCCTCATGCATCGGAGACACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCC GGGCGCTGTATGACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGT CCTGGATAGCTCCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTCCCTGCCAAC TACGTGGCACCCATGACCCGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291828 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291828.1, NP_001278757.1 |
RefSeq Size | 3138 bp |
RefSeq ORF | 654 bp |
Locus ID | 9402 |
UniProt ID | O75791 |
Protein Families | Druggable Genome |
Protein Pathways | T cell receptor signaling pathway |
Gene Summary | This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (5) lacks three internal exons, which results in an alternate downstream start codon, compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...