Human GCSF Receptor (CSF3R) activation kit by CRISPRa
CAT#: GA101015
CSF3R CRISPRa kit - CRISPR gene activation of human colony stimulating factor 3 receptor
CNY 12,255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CSF3R |
Locus ID | 1441 |
Kit Components | GA101015G1, GCSF Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGACGTCTTGGTGAGGCAC GA101015G2, GCSF Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACAGAATACGTAATGAAG GA101015G3, GCSF Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTACACAATTCCCTGGAACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_000760, NM_156038, NM_156039, NM_172313 |
Synonyms | CD114; GCSFR |
Summary | The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN408790 | CSF3R - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |