Human FUT2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FUT2
Locus ID	2524
Kit Components	GA101673G1, FUT2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCCCCAAGGAAGACCCTCG GA101673G2, FUT2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAAGGTCGCATCCCCCATC GA101673G3, FUT2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGGACTTTGTGGCCGGCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000511, NM_001097638
Synonyms	B12QTL1; SE; Se2; SEC2; sej
Summary	The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.