Human NFIX activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	NFIX
Locus ID	4784
Kit Components	GA103191G1, NFIX gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCGAACACAAAGCACACT GA103191G2, NFIX gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATGTCACGTCCAGAACGCC GA103191G3, NFIX gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGACGTGACATGTGTGGCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001271043, NM_001271044, NM_002501, NM_001365982, NM_001365983, NM_001365985, NM_001365902, NM_001365984
Synonyms	MRSHSS; NF1A; SOTOS2
Summary	The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.