Human USH2A activation kit by CRISPRa
CAT#: GA105097
USH2A CRISPRa kit - CRISPR gene activation of human usherin
CNY 12,255.00
CNY 15,390.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | USH2A |
Locus ID | 7399 |
Kit Components | GA105097G1, USH2A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGTATGCATGATCCCATCC GA105097G2, USH2A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCTGGTACCTCAAGCAGT GA105097G3, USH2A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGTACCAGCGGAAAGCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_007123, NM_206933 |
Synonyms | dJ1111A8.1; RP39; US2; USH2 |
Summary | This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN418839 | USH2A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |