Human SRRM2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SRRM2
Locus ID	23524
Kit Components	GA108368G1, SRRM2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTCCGTTCTTCGTTGCAC GA108368G2, SRRM2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCGTTGCACTGGCCAAC GA108368G3, SRRM2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCTTAGTCTTTCGGCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_016333
Synonyms	300-KD; Cwc21; CWF21; HSPC075; SRL300; SRm300
Summary	Required for pre-mRNA splicing as component of the spliceosome.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.