LRP5 Human qPCR Primer Pair (NM_002335)
CNY 1,140.00
Cited in 5 publications. |
Product images
CNY 11,048.00
CNY 2,710.00
CNY 10,360.00
Specifications
Product Data | |
Gene ID | 4041 |
Forward Sequence | GGACACCAACATGATCGAGTCG |
Reverse Sequence | CGCTCAATGCTGTGCAGATTCC |
Synonyms | BMND1; EVR1; EVR4; HBM; LR3; LRP-5; LRP-7; LRP7; OPPG; OPS; OPTA1; PCLD4; VBCH2 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (5)
The use of this Gene Expression has been cited in the following citations: |
---|
Identification of novel variants in the FZD4 gene associated with familial exudative vitreoretinopathy in Chinese families.
,null,
Clinical experimental ophthalmology
,PubMed ID 31765079
[LRP5]
|
Whole-Exome Sequencing Analysis Identified Novel Mutations in the TSPAN12 Gene in Chinese Families with Familial Exudative Vitreoretinopathy.
,null,
Genetic testing and molecular biomarkers
,PubMed ID 31513438
[LRP5]
|
TRAF6 function as a novel co-regulator of Wnt3a target genes in prostate cancer
,null,
EBioMedicine
,PubMed ID 31262711
[LRP5]
|
Nuclear factor I-C reciprocally regulates adipocyte and osteoblast differentiation via control of canonical Wnt signaling.
,null,
FASEB journal : official publication of the Federation of American Societies for Experimental Biology
,PubMed ID 28122918
[LRP5]
|
Identification of two novel LRP5 mutations in families with familial exudative vitreoretinopathy
,null,
Molecular Vision
,PubMed ID 24715757
[LRP5]
|
Documents
FAQs |
Resources
基因表达相关资源 |