Cd63 (NM_007653) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	C75951; ME491; Tspan30
Vector	PCMV6-Kan/Neo
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >BC083161 ACCACCAGCGGCACACGGGAGAAAGGCCCAACAGCCATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGT TTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCTGTGCAGTGGGATTGATCGCCATTGGTGTAGCGGT TCAGGTTGTCTTGAAGCAGGCCATTACCCATGAGACTACTGCTGGCTCGCTGTTGCCTGTGGTCATCATT GCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTC TCATGATTACATTTGCCATCTTCCTGTCTCTTATCATGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTA TGTGTTTAGAGACCAGGTGAAGTCAGAGTTTAATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAA GACAACAAAACAGCCACTATTTTGGACAAATTGCAGAAAGAAAATAACTGCTGTGGAGCTTCTAACTACA CAGACTGGGAAAACATCCCCGGCATGGCCAAGGACAGAGTCCCCGATTCTTGCTGCATCAACATAACTGT GGGCTGTGGGAATGATTTCAAGGAATCCACTATCCATACCCAGGGCTGCGTGGAGACTATAGCAATATGG CTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCCCTGGGCATTGCTTTTGTGGAGGTCTTGGGAATTA TCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTGGCTATGAAGTAATGTAGGGGTGGGGGGCGTTTGG TCTTTTCATGGAGTGGATTCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCAGACCTAAAAAAAAAAA AAAAAA
Restriction Sites	RsrII-NotI
ACCN	NM_007653
Insert Size	717 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	BC083161, AAH83161
RefSeq Size	846 bp
RefSeq ORF	717 bp
Locus ID	12512
UniProt ID	P41731
Gene Summary	Functions as cell surface receptor for TIMP1 and plays a role in the activation of cellular signaling cascades. Plays a role in the activation of ITGB1 and integrin signaling, leading to the activation of AKT, FAK/PTK2 and MAP kinases. Promotes cell survival, reorganization of the actin cytoskeleton, cell adhesion, spreading and migration, via its role in the activation of AKT and FAK/PTK2. Plays a role in VEGFA signaling via its role in regulating the internalization of KDR/VEGFR2. Plays a role in intracellular vesicular transport processes, and is required for normal trafficking of the PMEL luminal domain that is essential for the development and maturation of melanocytes. Plays a role in the adhesion of leukocytes onto endothelial cells via its role in the regulation of SELP trafficking. May play a role in mast cell degranulation in response to Ms4a2/FceRI stimulation, but not in mast cell degranulation in response to other stimuli.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2 and 3 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.