Asgr1 (NM_001291131) Mouse Untagged Clone

CAT#: MC226783

Asgr1 (untagged) - Mouse asialoglycoprotein receptor 1 (Asgr1), transcript variant 2



  "NM_001291131" in other vectors (1)

CNY 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms ASGPR1; Asgr; Asgr-1; HL-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226783 representing NM_001291131
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAAAGGATTATCAAGATTTCCAGCACCTGGACAATGATAATGACCATCATCAACTCCGGAGAGGGC
CGCCTCCCACTCCACGGCTCTTGCAGCGACTCTGCTCTGGATCCCGCCTCCTCCTGCTCTCCTCGAGCCT
CAGCATTCTGTTGCTGGTGGTTGTCTGTGTGATCACATCCCAAAATTCCCAACTCCGGGAAGATCTGCTG
GCTCTAAGGCAGAATTTCAGCAACCTCACTGTGAGCACTGAGGACCAGGTCAAGGCCCTGAGCACCCAGG
GAAGTAGTGTGGGAAGAAAGATGAAGTTAGTGGAGTCGAAGCTGGAAAAACAGCAGAAGGATCTGACTGA
AGATCACTCCAGTTTGCTACTGCACGTGAAGCAGTTAGTGTCTGACGTGCGAAGCTTGAGCTGCCAGATG
GCTGCATTTCGGGGCAATGGCTCTGAAAGGACCTGCTGCCCCATCAACTGGGTGGAGTATGAAGGCAGCT
GCTACTGGTTCTCCAGCTCTGTGAGGCCTTGGACTGAAGCTGACAAGTACTGCCAGCTGGAAAATGCCCA
TCTGGTGGTGGTGACCTCCAGGGATGAGCAGAACTTCCTCCAGCGCCACATGGGCCCCTTAAACACTTGG
ATTGGCCTAACTGACCAGAACGGGCCCTGGAAATGGGTGGATGGAACAGACTACGAGACAGGCTTCCAGA
ATTGGAGACCAGAGCAGCCAGATAACTGGTACGGACATGGGCTTGGAGGAGGCGAGGACTGTGCCCACTT
CACGACGGATGGCCGCTGGAATGACGACGTCTGCAGGAGGCCCTACCGCTGGGTCTGTGAGACAAAGTTG
GATAAGGCTAATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291131
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291131.1, NP_001278060.1
RefSeq Size 1150 bp
RefSeq ORF 855 bp
Locus ID 11889
UniProt ID P34927
Gene Summary Mediates the endocytosis of plasma glycoproteins to which the terminal sialic acid residue on their complex carbohydrate moieties has been removed. The receptor recognizes terminal galactose and N-acetylgalactosamine units. After ligand binding to the receptor, the resulting complex is internalized and transported to a sorting organelle, where receptor and ligand are disassociated. The receptor then returns to the cell membrane surface.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...