Aprataxin (APTX) (NM_175071) Human Untagged Clone

CAT#: SC312289

APTX (untagged)-Human aprataxin (APTX), transcript variant 5



  "NM_175071" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-APTX Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AOA; AOA1; aprataxin; ataxia 1, early onset with hypoalbuminemia; AXA1; EAOH; EOAHA; FHA-HIT; FLJ20157; MGC1072; OTTHUMP00000021188
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312289 representing NM_175071.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGACCCCAAAATGCAGGTTTACAAAGATGAGCAGGTGGTGGTGATAAAGGATAAATACCCAAAG
GCCCGTTACCATTGGCTGGTCTTACCGTGGACCTCCATTTCCAGTCTGAAGGCTGTGGCCAGGGAACAC
CTTGAACTCCTTAAGCATATGCACACTGTGGGGGAAAAGGTGATTGTAGATTTTGCTGGGTCCAGCAAA
CTCCGCTTCCGATTGGGCTACCACGCCATTCCGAGTATGAGCCATGTACATCTTCATGTGATCAGCCAG
GATTTTGATTCTCCTTGCCTTAAAAACAAAAAACATTGGAATTCTTTCAATACAGAATACTTCCTAGAA
TCACAAGCTGTGATCGAGATGGTACAAGAGGCTGGTAGAGTAACTGTCCGAGATGGGATGCCTGAGCTC
TTGAAGCTGCCCCTTCGTTGTCATGAGTGCCAGCAGCTGCTGCCTTCCATTCCTCAGCTGAAAGAACAT
CTCAGGAAGCACTGGACACAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_175071
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_175071.1
RefSeq Size 1836 bp
RefSeq ORF 507 bp
Locus ID 54840
Protein Families Druggable Genome
MW 19.7 kDa
Gene Summary This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Aug 2010]
Transcript Variant: This variant (5) contains multiple differences in the 5' UTR and coding region compared to variant 1. These differences result in translation initiation at a downstream in-frame ATG and an isoform (d) with a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...