CNOT7 (NM_013354) Human Untagged Clone
CAT#: SC317412
CNOT7 (untagged)-Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAF-1; CAF1; Caf1a; hCAF-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317412 representing NM_013354.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCAGCGGCAACTGTAGATCATAGCCAAAGAATTTGTGAAGTTTGGGCTTGCAACTTGGATGAAGAG ATGAAGAAAATTCGTCAAGTTATCCGAAAATATAATTACGTTGCTATGGACACCGAGTTTCCAGGTGTG GTTGCAAGACCCATTGGAGAATTCAGGAGCAATGCTGACTATCAATACCAACTATTGCGGTGTAATGTA GACTTGTTAAAGATAATTCAGCTAGGACTGACATTTATGAATGAGCAAGGAGAATACCCTCCAGGAACT TCAACTTGGCAGTTTAATTTTAAATTTAATTTGACGGAGGACATGTATGCCCAGGACTCTATAGAGCTA CTAACAACATCTGGTATCCAGTTTAAAAAACATGAGGAGGAAGGAATTGAAACCCAGTACTTTGCAGAA CTTCTTATGACTTCTGGAGTGGTCCTCTGTGAAGGGGTCAAATGGTTGTCATTTCATAGCGGTTACGAC TTTGGCTACTTAATCAAAATCCTAACCAACTCTAACTTGCCTGAAGAAGAACTTGACTTCTTTGAGATC CTTCGATTGTTTTTTCCTGTCATTTATGATGTGAAGTACCTCATGAAGAGCTGCAAAAATCTCAAAGGT GGATTACAGGAGGTGGCAGAACAGTTAGAGCTGGAACGGATAGGACCACAACATCAGGCAGGATCTGAT TCATTGCTCACAGGAATGGCCTTTTTCAAAATGAGAGAAATGTTCTTTGAAGATCATATTGATGATGCC AAATATTGTGGTCATTTGTATGGCCTTGGTTCTGGTTCATCCTATGTACAGAATGGCACAGGGAATGCA TATGAAGAGGAAGCCAACAAGCAGTCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_013354 |
Insert Size | 858 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013354.6 |
RefSeq Size | 2712 bp |
RefSeq ORF | 858 bp |
Locus ID | 29883 |
UniProt ID | Q9UIV1 |
Domains | CAF1 |
Protein Families | Transcription Factors |
Protein Pathways | RNA degradation |
MW | 32.7 kDa |
Gene Summary | The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (1) encodes isoform 1. Variants 1, 6, 7 and 8 all encode isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209293 | CNOT7 (Myc-DDK-tagged)-Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1 |
CNY 2,400.00 |
|
RC209293L1 | Lenti ORF clone of Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC209293L2 | Lenti ORF clone of Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC209293L3 | Lenti ORF clone of Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209293L4 | Lenti ORF clone of Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG209293 | CNOT7 (tGFP-tagged) - Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1 |
CNY 4,000.00 |
|
SC110405 | CNOT7 (untagged)-Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1 |
CNY 2,950.00 |