FABP3 (NM_004102) Human Untagged Clone
CAT#: SC321063
FABP3 (untagged)-Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3)
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FABP11; H-FABP; M-FABP; MDGI; O-FABP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004102.3
GCCGTCGGAGCCCTTGCACGCCTGCTCTCTTGTAGCTTCTCTCAGCCTAGCCCAGCATCA
CTATGGTGGACGCTTTCCTGGGCACCTGGAAGCTAGTGGACAGCAAGAATTTCGATGACT ACATGAAGTCACTCGGTGTGGGTTTTGCTACCAGGCAGGTGGCCAGCATGACCAAGCCTA CCACAATCATCGAAAAGAATGGGGACATTCTCACCCTAAAAACACACAGCACCTTCAAGA ACACAGAGATCAGCTTTAAGTTGGGGGTGGAGTTCGATGAGACAACAGCAGATGACAGGA AGGTCAAGTCCATTGTGACACTGGATGGAGGGAAACTTGTTCACCTGCAGAAATGGGACG GGCAAGAGACCACACTTGTGCGGGAGCTAATTGATGGAAAACTCATCCTGACACTCACCC ACGGCACTGCAGTTTGCACTCGCACTTATGAGAAAGAGGCATGACCTGACTGCACTGTTG CTGACTACTACTCTGCCAATCGGCTACCCCTCGACTCAGCACCACATTGCCTCATTTCTT CCTCTGCATTTTGTACAAATCCACGAATTCTTCTGGGGTCAGGTGCCACTGACCGGGATC CAGTTCCAGTTCCCATGGTGTATGTGGTTTTTTTTTTTTTTTTTTAACTGCACTCATAGG GTGCTCTGAGGTCAATAAAGCAGAGCCAAGGCCACCCAGTTGCCTTTTTGCCTTTGGTAA CATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004102 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004102.3, NP_004093.1 |
RefSeq Size | 1097 bp |
RefSeq ORF | 402 bp |
Locus ID | 2170 |
UniProt ID | P05413 |
Protein Pathways | PPAR signaling pathway |
Gene Summary | The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202737 | FABP3 (Myc-DDK-tagged)-Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3) |
CNY 1,200.00 |
|
RC202737L3 | Lenti ORF clone of Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202737L4 | Lenti ORF clone of Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3), mGFP tagged |
CNY 5,890.00 |
|
RG202737 | FABP3 (tGFP-tagged) - Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3) |
CNY 2,800.00 |
|
SC303434 | FABP3 (untagged)-Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3) |
CNY 3,990.00 |