MAX (NM_145114) Human Untagged Clone

CAT#: SC324151

MAX (untagged)-Human MYC associated factor X (MAX), transcript variant 4



  "NM_145114" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MAX mouse monoclonal antibody,clone OTI14G1
    • 100 ul

CNY 1,999.00
CNY 3,600.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHd4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_145114.1 GGTGGTTCTTGCCCGTGTTGTGTGTGTGTGTGAGTGAGAGAGCGAGTGAGTGAGTGAGTG
AGTGTGTGTGTGGGGGGGACTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACC
CCTTCCCCTCCCCGCCGCCGCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATA
ACGATGACATCGAGGTGGAGAGCGACGAAGAGCAACCGAGGTTTCAATCTGCGGCTGACA
AACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTC
ACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAGCTCTATTTCCTCTTTTGGA
AATTGTGTACTCCTGTCCTTCATCGTCAAAGTTTGATGCAGAAATGCCACACCTTCATTT
CAAGCTACCAAGTGCACAAGAAAAAAGAATGCAAGATTTAAAAAATGATTGTTTTGACCC
CTTACACAAATGTCTTACTCCTGGCTTTAATTAAGCTGCTTGAGGGCTGATAGCTCTGCC
TTTCCCTGGTAATCAGCAAAATGGTCCTGTGGCTGGGGAGGCCCTGGCAGCAGGAAGCCT
TCAAGGAGCCATGGGTCTGTGCTGACTCTGGCCTTACAACCTTCCAGCCTCCTTTGCTGG
CATTGATGGGGTTCCATTTTTGAATGAACTAGTTTAATGTGGATCCAAATTTATTGTGCA
TATTCTTTCGTTTTGGTTTTCAAAAGATGGCTTATTCACATGGAAATGTACACCAGTTTA
GCCCTGGGCCCTCCCTTTACCTTCATATGTGTAAAAGCTTACACAGGTTTCAGAAAATAA
ATGGTTTCATTTTCTCTAAAATAACTAGTACAAAATAAAACAGATGTCAGTTGTTGAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_145114
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145114.1, NP_660089.1
RefSeq Size 942 bp
RefSeq ORF 291 bp
Locus ID 4149
UniProt ID P61244
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway, Pathways in cancer, Small cell lung cancer
Gene Summary The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (4) lacks one alternate in-frame exon in the coding region and includes an alternate 3' terminal exon compared to variant 1. It encodes isoform d which is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...