PPHLN1 (NM_001143789) Human Untagged Clone

CAT#: SC325724

PPHLN1 (untagged)-Human periphilin 1 (PPHLN1), transcript variant 8



  "NM_001143789" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Periphilin Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CR; HSPC206; HSPC232
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325724 representing NM_001143789.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGTCTGAGGGACGATATGAATATGAAAGAATTCCGAGAGAACGAGCACCTCCTCGAAGTCATCCC
AGTGATGAATCTGGTTATAGATGGACAAGAGACGATCATTCTGCAAGCAGGCAACCTGAATACAGGGAC
ATGAGAGATGGCTTTAGAAGAAAAAGTTTCTACTCTTCCCATTATGCGAGAGAGCGGTCTCCTTATAAA
AGGGACAATACTTTTTTCAGAGAATCACCTGTTGGCCGAAAGGATTCTCCACACAGCAGATCTGGTTCC
AGTGTCAGTAGCAGAAGCTACTCTCCAGAAAGGAGCAAATCATACTCTTTCCATCAGTCTCAACATAGA
AATAAAGAGAGGCCTGTCCAGTCTTTGAAAACATCAAGAGATACTTCACCCTCAAGTGGTTCAGCAGTT
TCTTCATCAAAGGTGTTAGACAAACCCAGTAGGCTAACTGAAAAGGAACTTGCTGAGGCTGCAAGCAAG
TGGGCTGCTGAAAAGCTAGAGAAATCAGATGAAAGTAACTTGCCTGAAATTTCTGAGTATGAGGCGGGA
TCCACAGCACCATTGTTTACTGACCAGCCAGAGGAACCTGAGTCAAACACAACACATGGGATAGAATTA
TTTGAAGATAGTCAGCTAACCACTCGCTCTAAAGCAATAGCATCAAAAACCAAAGAGATTGAACAGGTT
TACCGACAAGACTGTGAAACTTTCGGGATGGTGGTGAAAATGCTGATTGAAAAAGATCCTTCATTAGAA
AAGTCTATACAGTTTGCATTGAGGCAGAATTTACATGAAATAGGTGAGCGGTGTGTTGAAGAACTCAAG
CATTTCATTGCAGAGTATGATACTTCCACTCAAGATTTTGGAGAGCCTTTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001143789
Insert Size 882 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143789.1
RefSeq Size 1455 bp
RefSeq ORF 882 bp
Locus ID 51535
MW 33.9 kDa
Gene Summary The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) lacks two alternate in-frame exons and has multiple differences in the 3' region when compared to variant 1. The resulting isoform (8) has a distinct and shorter C-terminus and lacks two internal segments compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...