hHR23b (RAD23B) (NM_001244713) Human Untagged Clone

CAT#: SC332086

RAD23B (untagged) - Homo sapiens RAD23 homolog B (S. cerevisiae) (RAD23B), transcript variant 2



  "NM_001244713" in other vectors (2)

CNY 3,710.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
RAD23B mouse monoclonal antibody, clone OTI7G10 (formerly 7G10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HHR23B; HR23B; P58
Vector pCMV6-Entry
Sequence Data
>SC332086 representing NM_001244713.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGAAAGCACTGAAAGAGAAGATTGAATCTGAAAAGGGGAAAGATGCCTTTCCAGTAGCAGGTCAA
AAATTAATTTATGCAGGCAAAATCCTCAATGATGATACTGCTCTCAAAGAATATAAAATTGATGAGAAA
AACTTTGTGGTGGTTATGGTGACCAAACCCAAAGCAGTGTCCACACCAGCACCAGCTACAACTCAGCAG
TCAGCTCCTGCCAGCACTACAGCAGTTACTTCCTCCACCACCACAACTGTGGCTCAGGCTCCAACCCCT
GTCCCTGCCTTGGCCCCCACTTCCACACCTGCATCCATCACTCCAGCATCAGCGACAGCATCTTCTGAA
CCTGCACCTGCTAGTGCAGCTAAACAAGAGAAGCCTGCAGAAAAGCCAGCAGAGACACCAGTGGCTACT
AGCCCAACAGCAACTGACAGTACATCGGGTGATTCTTCTCGGTCAAACCTTTTTGAAGATGCAACGAGT
GCACTTGTGACGGGTCAGTCTTACGAGAATATGGTAACTGAGATCATGTCAATGGGCTATGAACGAGAG
CAAGTAATTGCAGCCCTGAGAGCCAGTTTCAACAACCCTGACAGAGCAGTGGAGTATCTTTTAATGGGA
ATCCCTGGAGATAGAGAAAGTCAGGCTGTGGTTGACCCCCCTCAAGCAGCTAGTACTGGGGCTCCTCAG
TCTTCAGCAGTGGCTGCAGCTGCAGCAACTACGACAGCAACAACTACAACAACAAGTTCTGGAGGACAT
CCCCTTGAATTTTTACGGAATCAGCCTCAGTTTCAACAGATGAGACAAATTATTCAGCAGAATCCTTCC
TTGCTTCCAGCGTTACTACAGCAGATAGGTCGAGAGAATCCTCAATTACTTCAGCAAATTAGCCAACAC
CAGGAGCATTTTATTCAGATGTTAAATGAACCAGTTCAAGAAGCTGGTGGTCAAGGAGGAGGAGGTGGA
GGTGGCAGTGGAGGAATTGCAGAAGCTGGAAGTGGTCATATGAACTACATTCAAGTAACACCTCAGGAA
AAAGAAGCTATAGAAAGGTTAAAGGCATTAGGATTTCCTGAAGGACTTGTGATACAAGCGTATTTTGCT
TGTGAGAAGAATGAGAATTTGGCTGCCAATTTTCTTCTACAGCAGAACTTTGATGAAGATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244713
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244713.1
RefSeq Size 3852 bp
RefSeq ORF 1167 bp
Locus ID 5887
Protein Families Druggable Genome
Protein Pathways Nucleotide excision repair
MW 40.7 kDa
Gene Summary The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) has a distinct 5' UTR and 5' CDS, compared to isoform (1), which results in an isoform (2) with a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...