Cope (NM_021538) Mouse Untagged Clone

CAT#: MC203696

Cope (untagged) - Mouse coatomer protein complex, subunit epsilon (Cope), (10ug)



  "NM_021538" in other vectors (4)

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110005D17Rik; Cope1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC009170
CAGAAGAAGGTTTGTTAGAGGTGCGGTGACATGGCTCCTCCGGTTCCTGGCGCGGTCTCTGGCGGCTCCG GAGAGGTAGATGAGCTGTTCGACGTGAAGAACGCTTTCTACATCGGCAGCTACCAGCAGTGCATCAACGA GGCTCAGCGCGTGAAGCTCTCCAGTCCTGAGCGGGAAGTAGAGAGGGATGTCTTCCTATACAGAGCATAC CTCGCACAGAGGAAGTATGGCGTGGTCCTGGATGAGATCAAACCCTCCTCGGCCCCAGAACTCCAGGCTG TGCGCATGTTTGCTGAGTACCTTGCCAGTGAGAACCAGAGGGACAGCATCGTGCTGGAGCTGGATCGGGA GATGAGCAGGAGTGTGGATGTGACCAATACCACTTTCCTGCTCATGGCTGCCTCCATCTACTTCCACGAC CAGAACCCGGATGCAGCCCTGCGAACCCTGCACCAGGGTGACGGCCTTGAGTGCATGGCCATGACGATTC AGATCCTCCTCAAGCTGGACAGGCTGGACCTAGCCCGGAAGGAGCTGAAGAAGATGCAGGACCAAGATGA GGACGCCACCCTTACCCAGCTAGCCACTGCCTGGGTCAACCTGGCTGTGGGTGGTGAGAAGCTACAAGAA GCCTACTACATATTCCAAGAGCTGGCCGACAAGTGCTCCCCCACACTGCTGCTGCTCAATGGCCAGGCAG CCTGCCACTCGGCACAGGGCCGCTGGGAGACTGCAGAGGGTGTGCTGCAAGAGGCACTGGACAAGGACAG CGGCCACCCTGAGACCCTCATCAATCTCATTGTACTGTCACAGCACCTGGGCAAGCCCCCTGAGGTGACA AACCGATACTTGTCACAGCTGAAGGATGCACACAGGGCCCACCCCTTCATCAAGGAGTACCAGGCCAAGG AGAACGATTTCGATCGCCTGGCAATGCAGTATGCGCCCAGTGCTTAAAGTGGAGATGCCCTGGTGACCCC AACTGTGTGCCGCGGGATGCTGTCCTCCCTTTGTGTGTGGCAATAAAGTCTATCCATTATCAAAAAAAAA AAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_021538
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC009170, AAH09170
RefSeq Size 1056 bp
RefSeq ORF 927 bp
Locus ID 59042
UniProt ID O89079
Gene Summary The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. The coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. In mammals, the coatomer can only be recruited by membranes associated with ADP-ribosylation factors (ARFs), which are small GTP-binding proteins; the complex also influences the Golgi structural integrity, as well as the processing, activity, and endocytic recycling of LDL receptors (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...