TrueClones FAQs

OriGene's TrueClones are untagged cDNA clones with native stop codons. All clones are assessed for the completeness of the open reading frame only and with respect to the associated reference. The majority of TrueClones are in the pCMV6-XL4/XL5/XL6 vectors for transient overexpression in mammalian cells. Any of our TrueClones can be provided in a vector for stable over-expression (pCMV6-Neo) for a nominal fee.

TrueORFs are much more "engineered" than TrueClones. TrueORF inserts are just the coding sequence (Open Reading Frame, ORF) in our pCMV6-Entry Precision Shuttle vector, designed to put C-terminal Myc-DDK tag to the expressed protein. TrueORFs do not contain any UTR sequences, which would interfere with the expression of the C-terminal tag. The Open Reading Frame in any TrueORF can be easily shuttled to another OriGene destination vector with different tags or functions.

It really depends on the purpose of your experiments. For example, if you simply need to overexpress the protein under transient conditions, move the cDNA to your own vector, or use the clone as a template for PCR, then the TrueClone is a good choice. If you don't have a good antibody against your protein, need to easily purify your protein, or you need to make stable cell lines, the TrueORF is a good choice.

The most precise search of our website is by using the NCBI reference accession number of the mRNA transcript (e.g. NM_000123). This will bring up all products related to this reference sequence including TrueClone, ORF clone, antigen standard, RNAi products, and CRISPR knockout kits. If you don't know the NCBI reference accession number, use the gene symbol to search. This will often generate many more hits than expected because it is a simple text search that may return many splice variants and occasionally unwanted transcripts. If you get too many positives, we recommend that you search Entrez Gene from NCBI to find the reference accession number and then repeat the search of OriGene's website with the accession number. Go to http://www.ncbi.nlm.nih.gov/ and select gene from the dropdown menu on the left of the search box.

The majority of TrueClones were inserted into the pCMV6-XL4/XL5/XL6 vectors using a linker-based strategy. The linkers were ligated to the EcoRI (5`) and Sal I (3`) sites of the corresponding pCMV6-XL vector. For the 3` site, a Xho I linker was fused to the Sal I site, destroying both Xho I and Sal I in the process. These sites were not used for TrueClones in the pCMV6-AC or PCMV6-Entry vector. If you need more information on the cloning sites for a TrueClone, please contact our Technical Support Team.

No. Inserts were subcloned into the pCMV6-AC vector using various combinations of restriction enzymes appropriate to each specific cDNA. Please contact OriGene technical support for information on your specific construct.

For all TrueClones, OriGene posts the available sequence data on our website in each specific clone data table. 5' or 3' Read Nucleotide Sequence refers to an unedited sequence primed with a vector primer from the corresponding insert end. Sequence errors are likely to be present and therefore these reads should not be used for base-by-base analysis. Should the Open Reading Frame be covered by edited sequence, it is indicated by a link called "Edited Nucelotide Sequence". All TrueORF clone inserts are fully sequenced. Always note that the exact sequence of an OriGene clone may differ from the NCBI reference with respect to biological polymorphisms.

OriGene provides the full-length cDNA clone plus the VP1.5 (forward) and XL39 (reverse) vector sequencing primers. Should you need to amplify the plasmid DNA, we recommend that you end sequence with the VP1.5 (5') primer.

VP1.5, 5' GGACTTTCCAAAATGTCG 3' Tm=51C and XL39, 5' ATTAGGACAAGGCTGGTGGG 3' Tm=60C usually do not work well for amplification of the insert due to the large difference in their Tms. VP1.5 and XL39 are provided so that if you amplify the plasmid DNA, you can confirm your DNA prep by sequencing.

Because most of OriGene's TrueClones contain a polyA tail, the XL39 primer can fail to read through this region accurately. In these instances, we recommend sequencing with a gene-specific forward primer to get a good 3` read. It is also possible that OriGene's clone has a longer UTR than was present in the reference.

Lack of activity can occur for a wide variety of causes. First, be sure that the preparation of DNA that you are working with is of the expected concentration and is not a purified contaminant (from your lab or from OriGene). Secondly, check to see if your protein is being expressed in your cell type by Western blot. If it is not, next check for expression of the mRNA transcript by RT-PCR. These are very different problems with very different solutions. Once you know the source of the problem, please contact our technical support scientists for assistance at 888-267-4436 (USA) or techsupport@origene.com.

No. Every gene expression is different. Because the cDNA is driven by a strong promoter, mRNA can be expressed. However, a few factors can affect the steady state level of the protein of interest, including mRNA stability, protein translation efficiency and protein stability. Therefore, gene expression can not be guaranteed. This is the nature of genes. The sequence of a cDNA clone can be guaranteed to match the sequence posted on the website.

In most cases, you can use Not I to liberate the complete insert. There are two Not I sites outside of the cloning sites in all pCMV6-XL vectors. Although it is very rare for the 8-base cutter, Not I, to cut inside a mammalian gene, it is important to verify this before employing this strategy. TrueClone inserts in pCMV6-AC can not be released using this strategy.

Yes, we have tested our TrueClones for IVTT in rabbit reticulocyte lysate systems and have seen protein production. However, if your clone is in the XL4 vector, it is necessary to liberate the insert and the sense T7 promoter from the vector.

Here is our guideline:

Full Product Name, OriGene Technologies Inc., Rockville, MD, USA, Catalog #, Lot #.

In addition, we would love to hear from you when the paper is published. Email us a copy of the accepted manuscript and receive a special gift.