UBE2NL (NM_001012989) Human Untagged Clone
CAT#: SC301756
UBE2NL (untagged)-Human ubiquitin-conjugating enzyme E2N-like (UBE2NL)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Li174 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301756 representing NM_001012989.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGAGCTGCCCCACAGGATCATCAAGGAAACCCAGCGTTTGCTGGCAGAGCCAGTTCCTGGCATC AAAGCAGAACCAGATGAAAGCAACGCCCGTTATTTTCATGTGGTCATTGCTGGGGAATCAAAGGATTCC CCCTTTGAGGGAGGGACTTTTAAACGTGAACTATTACTTGCAGAAGAATACCCAATGGCAGCCCCTAAA GTACGTTTCATGACCAAAATTTATCATCCAAATGTAGACAAGTTGGAAAGAATAAGTTTAGATATTTTG AAAGATAAGTGGTCCCCAGCCCTGCAGATCCGCACAGTTCTGCTATCGATCCAGGCCTTGTTAAATGCT CCCAATCCAGATGATCCATTAGCAAATGATGTAGTGGAGCAGTGGAAGACCAACGAAGCCCAAGCCATT GAAACAGCTAGAGCATGGACTAGGCTATATGCCATGAATAGTATTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001012989 |
Insert Size | 462 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001012989.2 |
RefSeq Size | 1185 bp |
RefSeq ORF | 462 bp |
Locus ID | 389898 |
UniProt ID | Q5JXB2 |
Protein Pathways | Ubiquitin mediated proteolysis |
MW | 17.4 kDa |
Gene Summary | This gene is intronless and encodes a member of the ubiquitin-conjugating enzyme family. The protein product is 91% identical to ubiquitin-conjugating enzyme E2N, a multi-exon gene product. This locus represents a polymorphic pseudogene, where some individuals contain an allele that can encode a full-length protein, while others have a non-functional allele containing a premature stop codon (reference SNP rs237520) that truncates the coding sequence. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (coding) represents the functional allele, and can encode a full-length protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215865 | UBE2NL (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2N-like (UBE2NL) |
CNY 1,200.00 |
|
RC215865L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2N-like (UBE2NL), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC215865L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2N-like (UBE2NL), mGFP tagged |
CNY 5,890.00 |
|
RG215865 | UBE2NL (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2N-like (UBE2NL) |
CNY 4,370.00 |