Bone Sialoprotein (IBSP) (NM_004967) Human Untagged Clone
CAT#: SC303557
IBSP (untagged)-Human integrin-binding sialoprotein (IBSP)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BNSP; BSP; BSP-II; SP-II |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_004967 edited
ATGAAGACTGCTTTAATTTTGCTCAGCATTTTGGGAATGGCCTGTGCTTTCTCAATGAAA AATTTGCATCGAAGAGTCAAAATAGAGGATTCTGAAGAAAATGGGGTCTTTAAGTACAGG CCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTT CAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAA GAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCT GAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGCCT GGCACAGGGTATACAGGGTTAGCTGCAATCCAGCTTCCCAAGAAGGCTGGGGATATAACA AATAAAGCTACAAAAGAGAAGGAAAGTGATGAAGAAGAAGAGGAGGAAGAGGAAGGAAAT GAAAACGAAGAAAGCGAAGCAGAAGTGGATGAAAACGAACAAGGCATAAACGGCACCAGT ACCAACAGCACAGAGGCAGAAAACGGCAACGGCAGCAGCGGAGGAGACAATGGAGAAGAA GGGGAAGAAGAAAGTGTCACTGGAGCCAATGCAGAAGACACCACAGAGACCGGAAGGCAG GGCAAGGGCACCTCGAAGACAACAACCTCTCCAAATGGTGGGTTTGAACCTACAACCCCA CCACAAGTCTATAGAACCACTTCCCCACCTTTTGGGAAAACCACCACCGTTGAATACGAG GGGGAGTACGAATACACGGGCGCCAATGAATACGACAATGGATATGAAATCTATGAAAGT GAGAACGGGGAACCTCGTGGGGACAATTACCGAGCCTATGAAGATGAGTACAGCTACTTT AAAGGACAAGGCTACGATGGCTATGATGGTCAGAATTACTACCACCACCAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_004967 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | ORF matches with NM_004967.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004967.2, NP_004958.1 |
RefSeq Size | 1108 bp |
RefSeq ORF | 954 bp |
Locus ID | 3381 |
UniProt ID | P21815 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | ECM-receptor interaction, Focal adhesion |
Gene Summary | The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222901 | IBSP (Myc-DDK-tagged)-Human integrin-binding sialoprotein (IBSP) |
CNY 2,400.00 |
|
RC222901L3 | Lenti ORF clone of Human integrin-binding sialoprotein (IBSP), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222901L4 | Lenti ORF clone of Human integrin-binding sialoprotein (IBSP), mGFP tagged |
CNY 5,890.00 |
|
RG222901 | IBSP (tGFP-tagged) - Human integrin-binding sialoprotein (IBSP) |
CNY 4,000.00 |
其它Bone Sialoprotein产品