INMT (NM_006774) Human Untagged Clone

CAT#: SC303823

INMT (untagged)-Human indolethylamine N-methyltransferase (INMT), transcript variant 1



  "NM_006774" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
INMT Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TEMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303823 representing NM_006774.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGGTGGCTTCACTGGGGGTGATGAGTACCAGAAGCACTTCCTGCCCAGGGACTACTTGGCTACT
TACTACAGCTTCGATGGCAGCCCCTCACCCGAGGCCGAGATGCTGAAGTTTAACTTGGAATGTCTCCAC
AAGACCTTCGGCCCTGGAGGCCTCCAAGGGGACACGCTGATTGACATTGGCTCAGGTCCTACCATCTAC
CAAGTTCTTGCTGCCTGTGATTCCTTCCAAGACATCACTCTCTCCGACTTTACCGACCGCAACCGGGAG
GAGCTGGAAAAGTGGCTGAAGAAGGAGCCGGGGGCCTATGACTGGACCCCAGCGGTGAAATTCGCCTGT
GAGCTGGAAGGAAACAGCGGCCGATGGGAGGAGAAGGAGGAGAAGCTGCGGGCAGCGGTGAAGCGGGTG
CTCAAGTGCGATGTCCACCTGGGCAACCCGCTGGCCCCGGCTGTGTTGCCTCTCGCCGACTGTGTGCTC
ACCCTGCTGGCCATGGAGTGTGCCTGCTGTAGCCTTGATGCCTACCGCGCTGCCCTGTGCAACCTTGCC
TCACTGCTCAAGCCGGGTGGCCACCTGGTGACCACTGTCACGCTTCGGCTCCCGTCCTACATGGTGGGG
AAGCGTGAATTTTCCTGCGTGGCCCTGGAGAAAGAGGAGGTGGAGCAGGCTGTCCTGGATGCTGGCTTT
GACATTGAACAGCTCCTACACAGTCCCCAGAGCTACTCTGTCACCAATGCTGCCAACAATGGGGTCTGC
TTCATTGTGGCTCGCAAGAAGCCTGGGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_006774
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006774.4
RefSeq Size 2639 bp
RefSeq ORF 792 bp
Locus ID 11185
UniProt ID O95050
Protein Pathways Tryptophan metabolism
MW 28.9 kDa
Gene Summary N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream MINDY4 (aka FAM188B) gene. In rodents and other mammals such as cetartiodactyla this gene is in the opposite orientation compared to its orientation in human and other primates and this gene appears to have been lost in carnivora and chiroptera. [provided by RefSeq, Jul 2019]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...