SLC22A12 (NM_153378) Human Untagged Clone
CAT#: SC306598
SLC22A12 (untagged)-Human solute carrier family 22 (organic anion/urate transporter), member 12 (SLC22A12), transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OAT4L; RST; URAT1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_153378, the custom clone sequence may differ by one or more nucleotides
ATGGAGTGGACGGCGGCACGGGCCCGACCCTTGGTGATGACCTTGAACTCTCTGGGCTTC AGCTTCGGCCATGGCCTGACAGCTGCAGTGGCCTACGGTGTGCGGGACTGGACACTGCTG CAGCTGGTGGTCTCGGTCCCCTTCTTCCTCTGCTTTTTGTACTCCTGGTGGCTGGCAGAG TCGGCACGATGGCTCCTCACCACAGGCAGGCTGGATTGGGGCCTGCAGGAGCTGTGGAGG GTGGCTGCCATCAACGGAAAGGGGGCAGTGCAGGACACCCTGACCCCTGAGGTCTTGCTT TCAGCCATGCGGGAGGAGCTGAGCATGGGCCAGCCTCCTGCCAGCCTGGGCACCCTGCTC CGCATGCCCGGACTGCGCTTCCGGACCTGTATCTCCACGTTGTGCTGGTTCGCCTTTGGC TTCACCTTCTTCGGCCTGGCCCTGGACCTGCAGGCCCTGGGCAGCAACATCTTCCTGCTC CAAATGTTCATTGGTGTCGTGGACATCCCAGCCAAGATGGGCGCCCTGCTGCTGCTGAGC CACCTGGGCCGCCGCCCCACGCTGGCCGCATCCCTGTTGCTGGCAGGGCTCTGCATTCTG GCCAACACGCTGGTGCCCCACGAAATGGGGGCTCTGCGCTCAGCCTTGGCCGTGCTGGGG CTGGGCGGGGTGGGGGCTGCCTTCACCTGCATCACCATCTACAGCAGCGAGCTCTTCCCC ACTGTGCTCAGGATGACGGCAGTGGGCTTGGGCCAGATGGCAGCCCGTGGAGGAGCCATC CTGGGGCCTCTGGTCCGGCTGCTGGGTGTCCATGGCCCCTGGCTGCCCTTGCTGGTGTAT GGGACGGTGCCAGTGCTGAGTGGCCTGGCCGCACTGCTTCTGCCCGAGACCCAGAGCTTG CCGCTGCCCGACACCATCCAAGATGTGCAGAACCAGGCAGTAAAGAAGGCAACACATGGC ACGCTGGGGAACTCTGTCCTAAAATCCACACAGTTTTAG |
Restriction Sites | Please inquire |
ACCN | NM_153378 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153378.1, NP_700357.1 |
RefSeq Size | 2960 bp |
RefSeq ORF | 999 bp |
Locus ID | 116085 |
UniProt ID | Q96S37 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (2) contains alternate 5' exon structure, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233791 | SLC22A12 (Myc-DDK tagged) - Homo sapiens solute carrier family 22 (organic anion/urate transporter), member 12 (SLC22A12), transcript variant 2 |
CNY 3,990.00 |
|
RG233791 | SLC22A12 (tGFP-tagged) - Homo sapiens solute carrier family 22 (organic anion/urate transporter), member 12 (SLC22A12), transcript variant 2 |
CNY 4,370.00 |
|
SC333303 | SLC22A12 (untagged) - Homo sapiens solute carrier family 22 (organic anion/urate transporter), member 12 (SLC22A12), transcript variant 2 |
CNY 3,230.00 |
其它SLC22A12产品