KCNJ1 (NM_153766) Human Untagged Clone

CAT#: SC306659

KCNJ1 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k4



  "NM_153766" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-KCNJ1 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KIR1.1; ROMK; ROMK1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_153766, the custom clone sequence may differ by one or more nucleotides
ATGTTCAAACATCTTCGGAAATGGGTCGTCACTCGCTTTTTTGGGCATTCTCGGCAAAGA
GCAAGGCTAGTCTCCAAAGATGGAAGGTGCAACATAGAATTTGGCAATGTGGAGGCACAG
TCAAGGTTTATATTCTTTGTGGACATCTGGACAACGGTACTTGACCTCAAGTGGAGATAC
AAAATGACCATTTTCATCACAGCCTTCTTGGGGAGTTGGTTTTTCTTTGGTCTCCTGTGG
TATGCAGTAGCGTACATTCACAAAGACCTCCCGGAATTCCATCCTTCTGCCAATCACACT
CCCTGTGTGGAGAATATTAATGGCTTGACCTCAGCTTTTCTGTTTTCTCTGGAGACTCAA
GTGACCATTGGATATGGATTCAGGTGTGTGACAGAACAGTGTGCCACTGCCATTTTTCTG
CTTATCTTTCAGTCTATACTTGGAGTTATAATCAATTCTTTCATGTGTGGGGCCATCTTA
GCCAAGATCTCCAGGCCCAAAAAACGTGCCAAGACCATTACGTTCAGCAAGAACGCAGTG
ATCAGCAAACGGGGAGGGAAGCTTTGCCTCCTAATCCGAGTGGCTAATCTCAGGAAGAGC
CTTCTTATTGGCAGTCACATTTATGGAAAGCTTCTGAAGACCACAGTCACTCCTGAAGGA
GAGACCATTATTTTGGACCAGATCAATATCAACTTTGTAGTTGACGCTGGGAATGAAAAT
TTATTCTTCATCTCCCCATTGACAATTTACCATGTCATTGATCACAACAGCCCTTTCTTC
CACATGGCAGCGGAGACCCTTCTCCAGCAGGACTTTGAATTAGTGGTGTTTTTAGATGGC
ACAGTGGAGTCCACCAGTGCTACCTGCCAAGTCCGGACATCCTATGTCCCAGAGGAGGTG
CTTTGGGGCTACCGTTTTGCTCCCATAGTATCCAAGACAAAGGAAGGGAAATACCGAGTG
GATTTCCATAACTTTAGCAAGACAGTGGAAGTGGAGACCCCTCACTGTGCCATGTGCCTT
TATAATGAGAAAGATGTTAGAGCCAGGATGAAGAGAGGCTATGACAACCCCAACTTCATC
TTGTCAGAAGTCAATGAAACAGATGACACCAAAATGTAA
Restriction Sites Please inquire     
ACCN NM_153766
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153766.1, NP_722450.1
RefSeq Size 2616 bp
RefSeq ORF 1119 bp
Locus ID 3758
UniProt ID P48048
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4, also known as rom-k4) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter at the N-terminus than isoform a. Variants 2, 4 and 5 all encode isoform b but differ in their 5' UTRs.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...