NORE1 (RASSF5) (NM_182664) Human Untagged Clone

CAT#: SC307477

RASSF5 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 5 (RASSF5), transcript variant 2



  "NM_182664" in other vectors (4)

CNY 5,510.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RASSF5 (NORE1) mouse monoclonal antibody, clone OTI1H2 (formerly 1H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Maxp1; NORE1; NORE1A; NORE1B; RAPL; RASSF3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307477 representing NM_182664.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCATGGCGTCCCCGGCCATCGGGCAGCGCCCGTACCCGCTACTATTGGACCCCGAGCCGCCGCGC
TATCTACAGAGCCTGAGCGGCCCCGAGCTACCGCCGCCGCCCCCCGACCGGTCCTCGCGCCTCTGTGTC
CCGGCGCCCCTCTCCACTGCGCCCGGGGCGCGCGAGGGGCGCAGCGCCCGGAGGGCTGCCCGGGGGAAC
CTGGAGCCCCCGCCCCGGGCCTCCCGACCCGCTCGCCCGCTCCGGCCTGGTCTGCAGCAGAGACTGCGG
CGGCGGCCTGGAGCGCCCCGACCCCGCGACGTGCGGAGCATCTTCGAGCAGCCGCAGGATCCCAGAGTC
CCGGCGGAGCGAGGCGAGGGGCACTGCTTCGCCGAGTTGGTGCTGCCGGGCGGCCCCGGCTGGTGTGAC
CTGTGCGGACGAGAGGTGCTGCGGCAGGCGCTGCGCTGCACTAACTGTAAATTCACCTGTCACCCAGAA
TGCCGCAGCCTGATCCAGTTGGACTGCAGTCAGCAGGAGGGTTTATCCCGGGACAGACCCTCTCCAGAA
AGCACCCTCACCGTGACCTTCAGCCAGAATGTCTGTAAACCTGTGGAGGAGACACAGCGCCCGCCCACA
CTGCAGGAGATCAAGCAGAAGATCGACAGCTACAACACGCGAGAGAAGAACTGCCTGGGCATGAAACTG
AGTGAAGACGGCACCTACACGGGTTTCATCAAAGTGCATCTGAAACTCCGGCGGCCTGTGACGGTGCCT
GCTGGGATCCGGCCCCAGTCCATCTATGATGCCATCAAGGAGGTGAACCTGGCGGCTACCACGGACAAG
CGGACATCCTTCTACCTGCCCCTAGATGCCATCAAGCAGCTGCACATCAGCAGCACCACCACCGTCAGT
GAGGTCATCCAGGGGCTGCTCAAGAAGTTCATGGTTGTGGACAATCCCCAGAAGTTTGCACTTTTTAAG
CGGATACACAAGGACGGACAAGTGGGATGCCTTCTCCATCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_182664
Insert Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_182664.3
RefSeq Size 3537 bp
RefSeq ORF 1011 bp
Locus ID 83593
UniProt ID Q8WWW0
Protein Families Druggable Genome
Protein Pathways Leukocyte transendothelial migration, Non-small cell lung cancer, Pathways in cancer
MW 37.4 kDa
Gene Summary This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform B) is shorter and has a distinct C-terminus, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...