Parkin (PARK2) (NM_013988) Human Untagged Clone
CAT#: SC308936
PARK2 (untagged)-Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3
CNY 6,270.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AR-JP; LPRS2; PARK2; PDJ |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308936 representing NM_013988.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATAGTGTTTGTCAGGTTCAACTCCAGCCATGGTTTCCCAGTGGAGGTCGATTCTGACACCAGCATC TTCCAGCTCAAGGAGGTGGTTGCTAAGCGACAGGGGGTTCCGGCTGACCAGTTGCGTGTGATTTTCGCA GGGAAGGAGCTGAGGAATGACTGGACTGTGCAGGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCT GACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGC ACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTC CACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTG CCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAG CAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCC CGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAAGGGGGCAAT GGCCTGGGCTGTGGGTTTGCCTTCTGCCGGGAATGTAAAGAAGCGTACCATGAAGGGGAGTGCAGTGCC GTATTTGAAGCCTCAGGAACAACTACTCAGGCCTACAGAGTCGATGAAAGAGCCGCCGAGCAGGCTCGT TGGGAAGCAGCCTCCAAAGAAACCATCAAGAAAACCACCAAGCCCTGTCCCCGCTGCCATGTACCAGTG GAAAAAAATGGAGGCTGCATGCACATGAAGTGTCCGCAGCCCCAGTGCAGGCTCGAGTGGTGCTGGAAC TGTGGCTGCGAGTGGAACCGCGTCTGCATGGGGGACCACTGGTTCGACGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_013988 |
Insert Size | 951 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013988.2 |
RefSeq Size | 3626 bp |
RefSeq ORF | 951 bp |
Locus ID | 5071 |
UniProt ID | O60260 |
Domains | UBQ, IBR |
Protein Pathways | Parkinson's disease, Ubiquitin mediated proteolysis |
MW | 35.6 kDa |
Gene Summary | The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008] Transcript Variant: Transcript variant 3 lacks exons 3 to 5 present in the full-length transcript variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
PINK1-dependent recruitment of Parkin to mitochondria in mitophagy
,Cristofol Vives-Bauza, Chun Zhou, Yong Huang, Mei Cui, Rosa L.A. de Vries, Jiho Kim, Jessica May, Maja Aleksandra Tocilescu, Wencheng Liu, Han Seok Ko, Jordi Magrané, Darren J. Moore, Valina L. Dawson, Regis Grailhe, Ted M. Dawson, Chenjian Li, Kim Tieu, and Serge Przedborski,
PNAS, Dec 2009; 10.1073/pnas.0911187107
[PRKN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216186 | PARK2 (Myc-DDK-tagged)-Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3 |
CNY 3,600.00 |
|
RC216186L1 | Lenti ORF clone of Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC216186L2 | Lenti ORF clone of Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3, mGFP tagged |
CNY 6,000.00 |
|
RC216186L3 | Lenti ORF clone of Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216186L4 | Lenti ORF clone of Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG216186 | PARK2 (tGFP-tagged) - Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3 |
CNY 5,200.00 |