United States
Germany
Japan
United Kingdom
China
RBM38 (NM_017495) Human Untagged Clone
CAT＃: SC310609
RBM38 (untagged)-Human RNA binding motif protein 38 (RBM38), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dJ800J21.2; HSRNASEB; RNPC1; SEB4B; SEB4D |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_017495 edited
ATGCTGCTGCAGCCCGCGCCGTGCGCCCCGAGCGCGGGCTTCCCGCGGCCCCTGGCCGCC CCCGGCGCCATGCACGGCTCGCAGAAGGACACCACGTTCACCAAGATCTTCGTGGGCGGC CTGCCGTACCACACTACCGACGCCTCGCTCAGGAAGTACTTCGAGGGCTTCGGCGACATC GAGGAGGCCGTGGTCATCACCGACCGCCAGACGGGCAAGTCCCGCGGCTACGGCTTCGTG ACCATGGCCGACCGGGCGGCAGCTGAGAGGGCTTGCAAAGACCCGAACCCCATCATCGAC GGCCGCAAGGCCAACGTGAACCTGGCATATCTGGGCGCCAAGCCGCGGAGCCTCCAGACG GGCTTTGCCATTGGGGTGCAGCAGCTGCACCCCACCTTGATCCAGCGGACTTACGGGCTG ACCCCGCACTACATCTACCCACCAGCCATCGTGCAGCCCAGCGTGGTGATCCCAGCCGCC CCTGTCCCGTCGCTGTCCTCGCCCTACATTGAGTACACGCCGGCCAGCCCGGCCTACGCC CAGTACCCACCGGCCACCTATGACCAGTACCCATACGCCGCCTCGCCTGCCACGGCTGCC AGCTTCGTGGGCTACAGCTACCCTGCCGCCGTGCCCCAGGCCCTCTCAGCCGCAGCACCC GCGGGCACCACTTTCGTGCAGTACCAGGCGCCGCAGCTGCAGCCTGACAGGATGCAGTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_017495 |
| Insert Size | 2500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_017495.4, NP_059965.2 |
| RefSeq Size | 2401 bp |
| RefSeq ORF | 720 bp |
| Locus ID | 55544 |
| UniProt ID | Q9H0Z9 |
| Domains | RRM |
| Gene Summary | RNA-binding protein that specifically bind the 3' UTR of CDKN1A transcripts, leading to maintain the stability of CDKN1A transcripts, thereby acting as a mediator of the p53/TP53 family to regulate CDKN1A. CDKN1A is a cyclin-dependent kinase inhibitor transcriptionally regulated by the p53/TP53 family to induce cell cycle arrest. Isoform 1, but not isoform 2, has the ability to induce cell cycle arrest in G1 and maintain the stability of CDKN1A transcripts induced by p53/TP53. Also acts as a mRNA splicing factor. Specifically regulates the expression of FGFR2-IIIb, an epithelial cell-specific isoform of FGFR2. Plays a role in myogenic differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 5' coding region, compared to variant 3, resulting in an isoform (a) that is shorter than isoform c. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224422 | RBM38 (Myc-DDK-tagged)-Human RNA binding motif protein 38 (RBM38), transcript variant 1 |
CNY 3,600.00 |
|
| RC224422L3 | Lenti-ORF clone of RBM38 (Myc-DDK-tagged)-Human RNA binding motif protein 38 (RBM38), transcript variant 1 |
CNY 5,890.00 |
|
| RC224422L4 | Lenti-ORF clone of RBM38 (mGFP-tagged)-Human RNA binding motif protein 38 (RBM38), transcript variant 1 |
CNY 5,890.00 |
|
| RG224422 | RBM38 (tGFP-tagged) - Human RNA binding motif protein 38 (RBM38), transcript variant 1 |
CNY 5,200.00 |
