PP4R4 (PPP4R4) (NM_020958) Human Untagged Clone

CAT#: SC310683

PPP4R4 (untagged)-Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2



  "NM_020958" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PPP4R4 mouse monoclonal antibody,clone OTI1G7
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFAP14; KIAA1622; PP4R4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310683 representing NM_020958.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATCCGCCGCCGCCCGCCGCCGCGATGGATTTCAGTCAGAACAGCCTGTTCGGTTACATGGAGGAC
CTGCAGGAGCTCACCATCATCGAGAGGCCGGTCCGCCGGAGCCTCAAGACACCGGAAGAAATAGAAAGA
TTGACAGTCGATGAAGACCTCAGTGATATTGAAAGGGCTGTTTATCTGCTCAGTGCTGGTCAAGATGTC
CAAGGAACAAGTGTGATTGCAAATCTCCCATTTTTGATGCGACAGAATCCCACTGAGACGCTTCGGAGA
GTGTTGCCAAAAGTCAGAGTCCATGAGGATGCACACTTATTTATCCAGAGAGTATGGATCTCACATATG
TTTGTCCAGAGGGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_020958
Insert Size 363 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020958.2
RefSeq Size 923 bp
RefSeq ORF 363 bp
Locus ID 57718
UniProt ID Q6NUP7
Protein Families Phosphatase
MW 13.9 kDa
Gene Summary The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1, resulting in a shorter isoform (2) that has a distinct C-terminus lacking HEAT-like repeats.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...