United States
Germany
Japan
United Kingdom
China
Dectin 1 (CLEC7A) (NM_022570) Human Untagged Clone
CAT＃: SC312434
CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_022570 edited
ATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACTCAATTACACTTC GACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCGTGTGCTGCATCT CCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTAATACTGGTGATA GCTGTGGTCCTGGGTACCATGGGGGTTCTTTCCAGCCCTTGTCCTCCTAATTGGATTATA TATGAGAAGAGCTGTTATCTATTCAGCATGTCACTAAATTCCTGGGATGGAAGTAAAAGA CAATGCTGGCAACTGGGCTCTAATCTCCTAAAGATAGACAGCTCAAATGAATTGGGATTT ATAGTAAAACAAGTGTCTTCCCAACCTGATAATTCATTTTGGATAGGCCTTTCTCGGCCC CAGACTGAGGTACCATGGCTCTGGGAGGATGGATCAACATTCTCTTCTAACTTATTTCAG ATCAGAACCACAGCTACCCAAGAAAACCCATCTCCAAATTGTGTATGGATTCACGTGTCA GTCATTTATGACCAACTGTGTAGTGTGCCCTCATATAGTATTTGTGAGAAGAAGTTTTCA ATGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_022570 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_022570.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_022570.3, NP_072092.2 |
| RefSeq Size | 2454 bp |
| RefSeq ORF | 606 bp |
| Locus ID | 64581 |
| UniProt ID | Q9BXN2 |
| Domains | CLECT |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1, resulting in a shorter protein (isoform b) compared to isoform a. Variant 2 has been alternatively referred to as variant 1 and isoform b has been alternatively referred to as beta in the literature. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221791 | CLEC7A (Myc-DDK-tagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 2 |
CNY 3,990.00 |
|
| RC221791L3 | Lenti-ORF clone of CLEC7A (Myc-DDK-tagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 2 |
CNY 5,890.00 |
|
| RC221791L4 | Lenti-ORF clone of CLEC7A (mGFP-tagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 2 |
CNY 5,890.00 |
|
| RG221791 | CLEC7A (tGFP-tagged) - Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 2 |
CNY 5,440.00 |
其它Dectin 1产品
