zinc finger protein 655 (ZNF655) (NM_001085367) Human Untagged Clone
CAT#: SC316150
ZNF655 (untagged)-Human zinc finger protein 655 (ZNF655), transcript variant 10
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | VIK; VIK-1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001085367, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAAATACCAGCCCAGGAAGCAGCAGGGTCACCAAGGGTCCAGTTTCAGTCTTTG GAGACCCAGTCTGAGTGTCTGTCCCCAGAGCCTCAGTTTGTGCAGGACACCGACATGGAA CAGGGACTCACTGGGGCTCCACCTGTTCCTCAGGTGCCTGCTCTTCCCCGTGAGGGAAGC CCAGGAGACCAGGCAGCTGCGCTCTTGACAGCCAGGTACCAGGAGTTTGTGACATTCGAG GATGTGGCTGTGCACCTTACTCGAGAGGAATGGGGATACCTGGACCCTGTTCAGAGGGAC CTCTACAGAGAAGTGATGTTAGAGAATTATGGGAACGTGGTCTCACTGGGCATACTTCTC CGCCTTCCCACCACCCGGATTCATAGTGTGAATTCCTGCCCGGCCCTGAGTCATACCCAG GCAAGTGCTTTCTCTGGAGAAACACTTGCCGTCCTTACAGCAGGAATCTCCAAGAGATGG CCCAAGTATCGGCTTCCCATCGATATTGCTCGTCCCTGCTCGGAAACTCCTTTTCCACGA TTG |
Restriction Sites | Please inquire |
ACCN | NM_001085367 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001085367.1, NP_001078836.1 |
RefSeq Size | 1435 bp |
RefSeq ORF | 546 bp |
Locus ID | 79027 |
UniProt ID | Q8N720 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (10) has a distinct 5' UTR and includes alternate exons in the 3' coding region and 3' UTR, compared to variant 7. Both variants 2 and 10 encode the same isoform (b), which has a shorter and distinct C-terminus compared to isoform f. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215466 | ZNF655 (Myc-DDK-tagged)-Human zinc finger protein 655 (ZNF655), transcript variant 10 |
CNY 3,990.00 |
|
RC215466L3 | Lenti-ORF clone of ZNF655 (Myc-DDK-tagged)-Human zinc finger protein 655 (ZNF655), transcript variant 10 |
CNY 5,890.00 |
|
RC215466L4 | Lenti-ORF clone of ZNF655 (mGFP-tagged)-Human zinc finger protein 655 (ZNF655), transcript variant 10 |
CNY 5,890.00 |
|
RG215466 | ZNF655 (tGFP-tagged) - Human zinc finger protein 655 (ZNF655), transcript variant 10 |
CNY 4,370.00 |